miRTarBase - #MIRT562706


—
pre-miRNA Information
pre-miRNA hsa-mir-3921   
Genomic Coordinates chr3: 99964314 - 99964398
Description Homo sapiens miR-3921 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3921
Sequence 52| UCUCUGAGUACCAUAUGCCUUGU |74
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN7769671 6 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs758695096 5 dbSNP
rs539077798 6 dbSNP
rs954620527 10 dbSNP
rs1437951547 17 dbSNP
Putative Targets

Gene Information
Gene Symbol ZNF415   
Synonyms ZfLp
Description zinc finger protein 415
Transcript NM_001136038   
Other Transcripts NM_001164309 , NM_018355   
Expression
Putative miRNA Targets on ZNF415
3'UTR of ZNF415
(miRNA target sites are highlighted)		 
>ZNF415|NM_001136038|3'UTR
   1 TATGGCAAGGTCTTCAGTCAAAGTTTAAATCCTGTGAGTCATCAAAGAATTTATATCAGAGAGAAACCATACAAGTATAA
  81 TAAATGTGGCAAGGTTTTCAGTCACAATTCACTCCTACACAGCATCAGAGAATTTCATTCTTGAGAGAATCCTTACGAGT
 161 ACAGCAAACCCTTCATCACAAGTTCAAGCATTCATTGACATCAGAGTCCATGCTAAAGAGAAATCATATACACCTAACTG
 241 TGTGGCAGAGGCTTCATTTAGGTCTCACAACTCACTAGACATCAAAATGTGTAAACATCTTTGTATATTTTGTGCATGTT
 321 GAAGCTATTAACCAAGGATCAAAACTGTAACACATCCAAGGATTTATGTGAGGAATAATTCAGTCTAGTTGTGCTGATAA
 401 ACTTTTCATATTACACATTGTAGAACAAATGCAAGCCCAAATATGTTAAAACTCACACAACATGATATATATTAAAGGTT
 481 GCAGGATGTTTGAAGTCAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uguUCCGUA--UACCAUG-AGUCUCu 5'
             | ||||  || | || |||||| 
Target 5' ttcAAGCATTCATTG-ACATCAGAGt 3'
 183 - 207 129.00 -13.60
2 
miRNA  3' uguuccguauaccaugAGUCUCu 5'
                          |||||| 
Target 5' catcaaagaatttataTCAGAGa 3'
 40 - 62 120.00 -8.70
3 
miRNA  3' uguuccguauaccaugAGUCUCu 5'
                          |||||| 
Target 5' tcactcctacacagcaTCAGAGa 3'
 109 - 131 120.00 -9.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30498858 24 COSMIC
COSN20048525 27 COSMIC
COSN30459121 31 COSMIC
COSN30529873 35 COSMIC
COSN24032882 59 COSMIC
COSN31494133 93 COSMIC
COSN31482865 99 COSMIC
COSN31482899 126 COSMIC
COSN30164035 128 COSMIC
COSN31586543 130 COSMIC
COSN31583529 136 COSMIC
COSN31580896 193 COSMIC
COSN28195316 208 COSMIC
COSN16121334 220 COSMIC
COSN20716360 370 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs772350209 5 dbSNP
rs746089986 9 dbSNP
rs779249429 12 dbSNP
rs757554565 13 dbSNP
rs754268381 16 dbSNP
rs778231370 19 dbSNP
rs770531962 21 dbSNP
rs1181274057 22 dbSNP
rs748509067 23 dbSNP
rs927308527 25 dbSNP
rs756634238 30 dbSNP
rs751028097 31 dbSNP
rs1368658885 32 dbSNP
rs1282166314 36 dbSNP
rs574129828 37 dbSNP
rs368670021 38 dbSNP
rs1359980648 40 dbSNP
rs750039414 47 dbSNP
rs1422084028 48 dbSNP
rs1045993363 54 dbSNP
rs950285690 67 dbSNP
rs1456802056 71 dbSNP
rs1291307974 72 dbSNP
rs913464722 78 dbSNP
rs1387064117 105 dbSNP
rs988954086 107 dbSNP
rs1277870980 108 dbSNP
rs184627767 119 dbSNP
rs1411394037 120 dbSNP
rs868166114 142 dbSNP
rs925029203 149 dbSNP
rs979194798 156 dbSNP
rs1045764 157 dbSNP
rs918888187 163 dbSNP
rs1267304951 169 dbSNP
rs1357135548 170 dbSNP
rs973186208 171 dbSNP
rs1207628647 189 dbSNP
rs1291881476 193 dbSNP
rs1457435325 195 dbSNP
rs1017934038 197 dbSNP
rs1183389649 210 dbSNP
rs1255845728 225 dbSNP
rs1349264998 227 dbSNP
rs192915049 231 dbSNP
rs955286621 232 dbSNP
rs910425862 240 dbSNP
rs115920216 245 dbSNP
rs994409795 247 dbSNP
rs117645919 257 dbSNP
rs1368349210 258 dbSNP
rs1192578084 268 dbSNP
rs1308426809 270 dbSNP
rs1487716083 271 dbSNP
rs1378086354 274 dbSNP
rs1394285320 277 dbSNP
rs954656711 284 dbSNP
rs1017469342 289 dbSNP
rs1341195451 291 dbSNP
rs1227714889 297 dbSNP
rs572593605 312 dbSNP
rs1188985209 322 dbSNP
rs998704486 326 dbSNP
rs1255844413 328 dbSNP
rs1482475358 333 dbSNP
rs1184165837 338 dbSNP
rs967354128 354 dbSNP
rs1022010803 356 dbSNP
rs1187415952 359 dbSNP
rs1011693509 360 dbSNP
rs552841522 367 dbSNP
rs759910921 369 dbSNP
rs905883498 377 dbSNP
rs553381483 381 dbSNP
rs751697383 383 dbSNP
rs1358420811 385 dbSNP
rs1316513801 387 dbSNP
rs534395353 389 dbSNP
rs1257828191 393 dbSNP
rs1219578272 410 dbSNP
rs894546839 415 dbSNP
rs566960133 416 dbSNP
rs1434210409 429 dbSNP
rs1299425080 430 dbSNP
rs3814 443 dbSNP
rs907348095 445 dbSNP
rs1053263305 451 dbSNP
rs1229491078 456 dbSNP
rs936198954 461 dbSNP
rs1300825520 462 dbSNP
rs1310857188 463 dbSNP
rs536970184 465 dbSNP
rs1256906489 474 dbSNP
rs35419779 474 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_001164309 | 3UTR | CCUGUGAGUCAUCAAAGAAUUUAUAUCAGAGAGAAACCAUACAAGUAUAAUAAAUGUGGCAAGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000597503.1 | 3UTR | aauucacacuggggagaa
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
77 hsa-miR-3921 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT118184 ZNF544 zinc finger protein 544 2 2
MIRT332934 PRKAB2 protein kinase AMP-activated non-catalytic subunit beta 2 2 2
MIRT442165 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT442388 CLVS2 clavesin 2 2 2
MIRT442594 SIX1 SIX homeobox 1 2 2
MIRT448015 HLA-DOA major histocompatibility complex, class II, DO alpha 2 2
MIRT448062 MMP15 matrix metallopeptidase 15 2 2
MIRT489018 C1QTNF6 C1q and TNF related 6 2 2
MIRT494457 BTG2 BTG anti-proliferation factor 2 2 2
MIRT495651 SLC35B2 solute carrier family 35 member B2 2 2
MIRT504018 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT506778 KLHL15 kelch like family member 15 2 4
MIRT507230 FOXN2 forkhead box N2 2 4
MIRT512551 MFN2 mitofusin 2 2 6
MIRT512843 A1CF APOBEC1 complementation factor 2 6
MIRT513943 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT516104 GADL1 glutamate decarboxylase like 1 2 4
MIRT519832 ZFP69B ZFP69 zinc finger protein B 2 4
MIRT523209 HIST1H3E histone cluster 1 H3 family member e 2 2
MIRT525007 ACTN4 actinin alpha 4 2 6
MIRT528859 PKP1 plakophilin 1 2 2
MIRT529061 ZNF675 zinc finger protein 675 2 2
MIRT531720 TARS threonyl-tRNA synthetase 2 2
MIRT534038 STK4 serine/threonine kinase 4 2 2
MIRT543849 APIP APAF1 interacting protein 2 2
MIRT545865 ZNF264 zinc finger protein 264 2 4
MIRT556038 MXD1 MAX dimerization protein 1 2 2
MIRT561346 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT562706 ZNF415 zinc finger protein 415 2 2
MIRT563224 ZNF286A zinc finger protein 286A 2 2
MIRT563861 ZNF616 zinc finger protein 616 2 4
MIRT563880 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT564653 ZNF487P zinc finger protein 487 1 1
MIRT566596 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT570879 ZFP1 ZFP1 zinc finger protein 2 2
MIRT573069 TRIB1 tribbles pseudokinase 1 2 2
MIRT573940 ZNF708 zinc finger protein 708 2 2
MIRT575967 Slfn5 schlafen 5 2 5
MIRT607294 CD300E CD300e molecule 2 4
MIRT608188 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT609538 ADPRH ADP-ribosylarginine hydrolase 2 2
MIRT610153 PRMT8 protein arginine methyltransferase 8 2 4
MIRT611572 SLFN5 schlafen family member 5 2 7
MIRT613336 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT616561 ZNF512B zinc finger protein 512B 2 2
MIRT617239 SPATS2 spermatogenesis associated serine rich 2 2 2
MIRT618012 SLC9A3R2 SLC9A3 regulator 2 2 2
MIRT618479 IL17REL interleukin 17 receptor E like 2 2
MIRT619100 IFI44L interferon induced protein 44 like 2 2
MIRT622266 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT623081 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT625622 LILRB2 leukocyte immunoglobulin like receptor B2 2 2
MIRT627845 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT630460 GMPS guanine monophosphate synthase 2 2
MIRT630525 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 4
MIRT631503 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT634538 MRPS17 mitochondrial ribosomal protein S17 2 2
MIRT638808 DCTN3 dynactin subunit 3 2 2
MIRT641304 SLAMF1 signaling lymphocytic activation molecule family member 1 2 2
MIRT648348 PPP1R16B protein phosphatase 1 regulatory subunit 16B 2 2
MIRT649706 ZNF175 zinc finger protein 175 2 2
MIRT652555 TLX1 T-cell leukemia homeobox 1 2 2
MIRT655563 P2RX7 purinergic receptor P2X 7 2 2
MIRT659066 DEPTOR DEP domain containing MTOR interacting protein 2 2
MIRT660342 BCAT1 branched chain amino acid transaminase 1 2 2
MIRT664331 RAB8A RAB8A, member RAS oncogene family 2 2
MIRT688935 ATXN7L3B ataxin 7 like 3B 2 2
MIRT689972 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT699515 SKIL SKI like proto-oncogene 2 2
MIRT699976 RREB1 ras responsive element binding protein 1 2 2
MIRT702675 IRS2 insulin receptor substrate 2 2 2
MIRT709358 ULK2 unc-51 like autophagy activating kinase 2 2 2
MIRT709838 PAQR7 progestin and adipoQ receptor family member 7 2 2
MIRT718717 ANKRD18A ankyrin repeat domain 18A 2 2
MIRT718880 PDIA3 protein disulfide isomerase family A member 3 2 2
MIRT724106 TMEM199 transmembrane protein 199 2 2
MIRT724764 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3921 Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3921 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-3921 Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3921 Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-3921 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-3921 Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-3921 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-3921 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3921 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)

Error report submission