pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-215 |
Genomic Coordinates | chr1: 220117853 - 220117962 |
Synonyms | MIRN215, miRNA215, mir-215, MIR215 |
Description | Homo sapiens miR-215 stem-loop |
Comment | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences . |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-215-3p | |||||||||||||||||||||
Sequence | 64| UCUGUCAUUUCUUUAGGCCAAUA |86 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SLC29A1 | ||||||||||||||||||||
Synonyms | ENT1 | ||||||||||||||||||||
Description | solute carrier family 29 member 1 (Augustine blood group) | ||||||||||||||||||||
Transcript | NM_001078175 | ||||||||||||||||||||
Other Transcripts | NM_001078177 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SLC29A1 | |||||||||||||||||||||
3'UTR of SLC29A1 (miRNA target sites are highlighted) |
>SLC29A1|NM_001078175|3'UTR 1 CAAAGGATGGACAGAAGGACTGCCTGCCTCCCTCCCTGTCTGCCTCCTGCCCCTTCCTTCTGCCAGGGGTGATCCTGAGT 81 GGTCTGGCGGTTTTTTCTTCTAACTGACTTCTGCTTTCCACGGCGTGTGCTGGGCCCGGATCTCCAGGCCCTGGGGAGGG 161 AGCCTCTGGACGGACAGTGGGGACATTGTGGGTTTGGGGCTCAGAGTCGAGGGACGGGGTGTAGCCTCGGCATTTGCTTG 241 AGTTTCTCCACTCTTGGCTCTGACTGATCCCTGCTTGTGCAGGCCAGTGGAGGCTCTTGGGCTTGGAGAACACGTGTGTC 321 TCTGTGTATGTGTCTGTGTGTCTGCGTCCGTGTCTGTCAGACTGTCTGCCTGTCCTGGGGTGGCTAGGAGCTGGGTCTGA 401 CCGTTGTATGGTTTGACCTGATATACTCCATTCTCCCCTGCGCCTCCTCCTCTGTGTTCTCTCCATGTCCCCCTCCCAAC 481 TCCCCATGCCCAGTTCTTACCCATCATGCACCCTGTACAGTTGCCACGTTACTGCCTTTTTTAAAAATATATTTGACAGA 561 AACCAGGTGCCTTCAGAGGCTCTCTGATTTAAATAAACCTTTCTTGTTTTTTTCTCCATGGCTAAAAAAAAAAAAAAAAA 641 A Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
CLIP-seq Support 1 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000393844.1 | 3UTR | CCACGUUACUGCCUUUUUUAAAAAUAUAUUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
96 hsa-miR-215-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT058509 | TEAD1 | TEA domain transcription factor 1 | 2 | 2 | ||||||||
MIRT445625 | TMEM50A | transmembrane protein 50A | 2 | 2 | ||||||||
MIRT449286 | RPP14 | ribonuclease P/MRP subunit p14 | 2 | 2 | ||||||||
MIRT456702 | LDB1 | LIM domain binding 1 | 2 | 2 | ||||||||
MIRT467723 | SLC38A1 | solute carrier family 38 member 1 | 2 | 2 | ||||||||
MIRT474253 | LATS2 | large tumor suppressor kinase 2 | 2 | 2 | ||||||||
MIRT481811 | AP4E1 | adaptor related protein complex 4 epsilon 1 subunit | 2 | 2 | ||||||||
MIRT491969 | USP37 | ubiquitin specific peptidase 37 | 2 | 2 | ||||||||
MIRT513203 | RFT1 | RFT1 homolog | 2 | 2 | ||||||||
MIRT532737 | CMTM6 | CKLF like MARVEL transmembrane domain containing 6 | 2 | 2 | ||||||||
MIRT535706 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | 2 | 2 | ||||||||
MIRT536138 | MAPK14 | mitogen-activated protein kinase 14 | 2 | 2 | ||||||||
MIRT536463 | KLF12 | Kruppel like factor 12 | 2 | 4 | ||||||||
MIRT552615 | ZBTB8A | zinc finger and BTB domain containing 8A | 2 | 2 | ||||||||
MIRT554011 | SPIRE1 | spire type actin nucleation factor 1 | 2 | 2 | ||||||||
MIRT563259 | SLC29A1 | solute carrier family 29 member 1 (Augustine blood group) | 2 | 2 | ||||||||
MIRT571054 | POLQ | DNA polymerase theta | 2 | 4 | ||||||||
MIRT573556 | TMEM120B | transmembrane protein 120B | 2 | 2 | ||||||||
MIRT573772 | PRKAG1 | protein kinase AMP-activated non-catalytic subunit gamma 1 | 2 | 2 | ||||||||
MIRT575328 | Fbxo6 | F-box protein 6 | 2 | 2 | ||||||||
MIRT575497 | Sept3 | septin 3 | 2 | 5 | ||||||||
MIRT607051 | IDS | iduronate 2-sulfatase | 2 | 2 | ||||||||
MIRT607070 | POM121L7 | POM121 transmembrane nucleoporin like 7 pseudogene | 2 | 2 | ||||||||
MIRT607497 | HEBP2 | heme binding protein 2 | 2 | 2 | ||||||||
MIRT607799 | RHBDL2 | rhomboid like 2 | 2 | 2 | ||||||||
MIRT610832 | COL9A1 | collagen type IX alpha 1 chain | 2 | 2 | ||||||||
MIRT616853 | DSG2 | desmoglein 2 | 2 | 2 | ||||||||
MIRT617154 | C18orf42 | A-kinase anchor inhibitor 1 | 2 | 2 | ||||||||
MIRT620823 | MKI67IP | nucleolar protein interacting with the FHA domain of MKI67 | 1 | 1 | ||||||||
MIRT625698 | OPTN | optineurin | 2 | 2 | ||||||||
MIRT628082 | KAT7 | lysine acetyltransferase 7 | 2 | 2 | ||||||||
MIRT633540 | PGBD5 | piggyBac transposable element derived 5 | 2 | 2 | ||||||||
MIRT634343 | SGOL1 | shugoshin 1 | 2 | 2 | ||||||||
MIRT634605 | KIAA1919 | major facilitator superfamily domain containing 4B | 2 | 2 | ||||||||
MIRT636759 | SLC16A5 | solute carrier family 16 member 5 | 2 | 2 | ||||||||
MIRT637044 | SEPT3 | septin 3 | 2 | 7 | ||||||||
MIRT637213 | TRUB2 | TruB pseudouridine synthase family member 2 | 2 | 2 | ||||||||
MIRT639634 | ZSCAN23 | zinc finger and SCAN domain containing 23 | 2 | 2 | ||||||||
MIRT640818 | GPR107 | G protein-coupled receptor 107 | 2 | 2 | ||||||||
MIRT641033 | PITPNB | phosphatidylinositol transfer protein beta | 2 | 2 | ||||||||
MIRT641545 | MOCOS | molybdenum cofactor sulfurase | 2 | 2 | ||||||||
MIRT642091 | FBXL2 | F-box and leucine rich repeat protein 2 | 2 | 2 | ||||||||
MIRT645528 | ZWINT | ZW10 interacting kinetochore protein | 2 | 2 | ||||||||
MIRT647017 | ADCY2 | adenylate cyclase 2 | 2 | 2 | ||||||||
MIRT648044 | FADS6 | fatty acid desaturase 6 | 2 | 2 | ||||||||
MIRT648514 | PIGG | phosphatidylinositol glycan anchor biosynthesis class G | 2 | 2 | ||||||||
MIRT648869 | ABCA6 | ATP binding cassette subfamily A member 6 | 2 | 2 | ||||||||
MIRT656722 | LMLN | leishmanolysin like peptidase | 2 | 2 | ||||||||
MIRT658260 | FAXC | failed axon connections homolog | 2 | 2 | ||||||||
MIRT659063 | DEPTOR | DEP domain containing MTOR interacting protein | 2 | 2 | ||||||||
MIRT659364 | CRISPLD2 | cysteine rich secretory protein LCCL domain containing 2 | 2 | 2 | ||||||||
MIRT660318 | BDP1 | B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB | 2 | 2 | ||||||||
MIRT663345 | ZNF74 | zinc finger protein 74 | 2 | 2 | ||||||||
MIRT663526 | MASTL | microtubule associated serine/threonine kinase like | 2 | 2 | ||||||||
MIRT663975 | ZNF786 | zinc finger protein 786 | 2 | 2 | ||||||||
MIRT664354 | C16orf45 | chromosome 16 open reading frame 45 | 2 | 2 | ||||||||
MIRT664473 | ZYG11B | zyg-11 family member B, cell cycle regulator | 2 | 2 | ||||||||
MIRT664975 | TDRD1 | tudor domain containing 1 | 2 | 2 | ||||||||
MIRT665488 | VPS53 | VPS53, GARP complex subunit | 2 | 2 | ||||||||
MIRT667758 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | 2 | 2 | ||||||||
MIRT669552 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | 2 | 2 | ||||||||
MIRT670183 | CCDC142 | coiled-coil domain containing 142 | 2 | 2 | ||||||||
MIRT671342 | FAM71F2 | family with sequence similarity 71 member F2 | 2 | 2 | ||||||||
MIRT671873 | ZNF429 | zinc finger protein 429 | 2 | 2 | ||||||||
MIRT672018 | PXMP4 | peroxisomal membrane protein 4 | 2 | 2 | ||||||||
MIRT672068 | KIAA0930 | KIAA0930 | 2 | 2 | ||||||||
MIRT672551 | BRMS1L | breast cancer metastasis-suppressor 1 like | 2 | 2 | ||||||||
MIRT672849 | ICOSLG | inducible T-cell costimulator ligand | 2 | 2 | ||||||||
MIRT672988 | KBTBD6 | kelch repeat and BTB domain containing 6 | 2 | 2 | ||||||||
MIRT673088 | AK1 | adenylate kinase 1 | 2 | 2 | ||||||||
MIRT673578 | KDELC2 | KDEL motif containing 2 | 2 | 2 | ||||||||
MIRT674582 | SLC35B4 | solute carrier family 35 member B4 | 2 | 2 | ||||||||
MIRT674999 | STRN3 | striatin 3 | 2 | 2 | ||||||||
MIRT675596 | ZNF106 | zinc finger protein 106 | 2 | 2 | ||||||||
MIRT675778 | YIPF4 | Yip1 domain family member 4 | 2 | 2 | ||||||||
MIRT676029 | C9orf69 | transmembrane protein 250 | 2 | 2 | ||||||||
MIRT679015 | MTMR10 | myotubularin related protein 10 | 2 | 2 | ||||||||
MIRT679169 | PSMB2 | proteasome subunit beta 2 | 2 | 2 | ||||||||
MIRT687413 | NRIP1 | nuclear receptor interacting protein 1 | 2 | 2 | ||||||||
MIRT688038 | GNE | glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase | 2 | 2 | ||||||||
MIRT691644 | SLC43A3 | solute carrier family 43 member 3 | 2 | 2 | ||||||||
MIRT695630 | SLC26A2 | solute carrier family 26 member 2 | 2 | 2 | ||||||||
MIRT697562 | ZBTB10 | zinc finger and BTB domain containing 10 | 2 | 2 | ||||||||
MIRT699153 | SMC1A | structural maintenance of chromosomes 1A | 2 | 2 | ||||||||
MIRT699683 | SFMBT2 | Scm like with four mbt domains 2 | 2 | 2 | ||||||||
MIRT702177 | LYRM4 | LYR motif containing 4 | 2 | 2 | ||||||||
MIRT706217 | ACOT9 | acyl-CoA thioesterase 9 | 2 | 2 | ||||||||
MIRT711243 | TRAT1 | T-cell receptor associated transmembrane adaptor 1 | 2 | 2 | ||||||||
MIRT712343 | NLN | neurolysin | 2 | 2 | ||||||||
MIRT716574 | HOPX | HOP homeobox | 2 | 2 | ||||||||
MIRT717443 | TENM1 | teneurin transmembrane protein 1 | 2 | 2 | ||||||||
MIRT717759 | KCNRG | potassium channel regulator | 2 | 2 | ||||||||
MIRT717945 | TUBD1 | tubulin delta 1 | 2 | 2 | ||||||||
MIRT718343 | PURA | purine rich element binding protein A | 2 | 2 | ||||||||
MIRT718773 | ABHD15 | abhydrolase domain containing 15 | 2 | 2 | ||||||||
MIRT737073 | FOXM1 | forkhead box M1 | 2 | 0 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|