pre-miRNA Information
pre-miRNA hsa-mir-2115   
Genomic Coordinates chr3: 48316360 - 48316459
Description Homo sapiens miR-2115 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-2115-3p
Sequence 58| CAUCAGAAUUCAUGGAGGCUAG |79
Evidence Experimental
Experiments 454
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31490809 22 COSMIC
COSN31579735 22 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs543123304 18 dbSNP
rs1450988157 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC3A2   
Synonyms 4F2, 4F2HC, 4T2HC, CD98, CD98HC, MDU1, NACAE
Description solute carrier family 3 member 2
Transcript NM_001012662   
Other Transcripts NM_001012664 , NM_001013251 , NM_002394   
Expression
Putative miRNA Targets on SLC3A2
3'UTR of SLC3A2
(miRNA target sites are highlighted)
>SLC3A2|NM_001012662|3'UTR
   1 CTTCAGCCTGACATGGACCCACTACCCTTCTCCTTTCCTTCCCAGGCCCTTTGGCTTCTGATTTTTCTCTTTTTTAAAAA
  81 CAAACAAACAAACTGTTGCAGATTATGAGTGAACCCCCAAATAGGGTGTTTTCTGCCTTCAAATAAAAGTCACCCCTGCA
 161 TGGTGAAGTCTTCCCTCTGCTTCTCTCATAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gaUCGGAGGUACUUAAGACUAc 5'
            || | |: ||: ||||||| 
Target 5' ccAGGCCCTTTGGCTTCTGATt 3'
42 - 63 160.00 -14.50
2
miRNA  3' gaUCGGAGGU-------ACUUAAGACuac 5'
            | || |||       ||  |||||   
Target 5' tgAACCCCCAAATAGGGTGTTTTCTGcct 3'
110 - 138 108.00 -9.20
3
miRNA  3' gaucgGAGGUACUUAAGACUac 5'
               :| ||  :||| |||  
Target 5' aactgTTGCA--GATTATGAgt 3'
91 - 110 97.00 -5.94
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30456046 16 COSMIC
COSN30107222 69 COSMIC
COSN30191293 70 COSMIC
COSN30458378 70 COSMIC
COSN26491910 163 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1333466576 5 dbSNP
rs1394552921 10 dbSNP
rs763110992 11 dbSNP
rs764565542 14 dbSNP
rs751836727 15 dbSNP
rs1213274075 16 dbSNP
rs757845304 19 dbSNP
rs367966973 21 dbSNP
rs1283246093 30 dbSNP
rs1051237 31 dbSNP
rs761985608 31 dbSNP
rs372155732 32 dbSNP
rs1198685488 34 dbSNP
rs566207967 41 dbSNP
rs754543205 43 dbSNP
rs1211238946 44 dbSNP
rs1222988398 52 dbSNP
rs1051285 59 dbSNP
rs1051289 68 dbSNP
rs1051290 70 dbSNP
rs1414732389 70 dbSNP
rs1173764575 71 dbSNP
rs1240069446 76 dbSNP
rs181564225 76 dbSNP
rs1179395608 78 dbSNP
rs539927144 78 dbSNP
rs1256788721 85 dbSNP
rs933906958 92 dbSNP
rs371263694 94 dbSNP
rs1288648979 95 dbSNP
rs1802911 96 dbSNP
rs1386300745 100 dbSNP
rs796348269 104 dbSNP
rs185711029 106 dbSNP
rs1802910 116 dbSNP
rs1445485692 117 dbSNP
rs1372803512 125 dbSNP
rs1051342 134 dbSNP
rs934645209 145 dbSNP
rs6932 152 dbSNP
rs942332415 154 dbSNP
rs867417209 158 dbSNP
rs892888836 161 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000377892.1 | 3UTR | AUUUUUCUCUUUUUUAAAAACAAACAAACAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.314 0.04 0.318 0.04 31 Click to see details
HNSC 0.297 0.15 0.429 0.06 14 Click to see details
LUSC 0.265 0.17 0.271 0.16 15 Click to see details
LIHC -0.618 0.19 -0.800 0.1 4 Click to see details
STAD 0.757 0.23 0.500 0.33 3 Click to see details
BLCA -0.117 0.41 -0.029 0.48 6 Click to see details
UCEC 0.26 0.42 0.500 0.33 3 Click to see details
UCEC 0.26 0.42 0.500 0.33 3 Click to see details
UCEC 0.26 0.42 0.500 0.33 3 Click to see details
UCEC 0.26 0.42 0.500 0.33 3 Click to see details
UCEC 0.26 0.42 0.500 0.33 3 Click to see details
UCEC 0.26 0.42 0.500 0.33 3 Click to see details
UCEC 0.26 0.42 0.500 0.33 3 Click to see details
80 hsa-miR-2115-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057089 DDIT4 DNA damage inducible transcript 4 2 2
MIRT071216 FCF1 FCF1, rRNA-processing protein 2 2
MIRT226901 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT235961 BACH1 BTB domain and CNC homolog 1 2 2
MIRT294569 ZNF460 zinc finger protein 460 2 4
MIRT321046 RAC1 Rac family small GTPase 1 2 4
MIRT359666 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 8
MIRT366451 KLHL15 kelch like family member 15 2 2
MIRT405375 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT441794 TCEAL5 transcription elongation factor A like 5 2 2
MIRT443295 TCEAL3 transcription elongation factor A like 3 2 2
MIRT455275 DDX39B DExD-box helicase 39B 2 2
MIRT458523 C5orf22 chromosome 5 open reading frame 22 2 2
MIRT464960 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT466848 STX6 syntaxin 6 2 2
MIRT469252 RHOB ras homolog family member B 2 2
MIRT469825 RAB14 RAB14, member RAS oncogene family 2 4
MIRT470047 PTGFRN prostaglandin F2 receptor inhibitor 2 2
MIRT471420 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT472024 NPM1 nucleophosmin 1 2 2
MIRT484156 CENPN centromere protein N 2 2
MIRT485490 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT490462 PROSER2 proline and serine rich 2 2 2
MIRT493069 MTCH1 mitochondrial carrier 1 2 2
MIRT493573 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT494919 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 2 2
MIRT500439 ZMAT3 zinc finger matrin-type 3 2 2
MIRT500931 SRPR SRP receptor alpha subunit 2 4
MIRT501551 POC1B-GALNT4 POC1B-GALNT4 readthrough 2 2
MIRT501809 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT502415 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 2 2
MIRT506504 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT507861 CCNE2 cyclin E2 2 2
MIRT510511 YOD1 YOD1 deubiquitinase 2 6
MIRT516073 RAB42 RAB42, member RAS oncogene family 2 2
MIRT519030 KYNU kynureninase 2 6
MIRT521762 PPIL1 peptidylprolyl isomerase like 1 2 4
MIRT522898 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 4
MIRT527370 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT530691 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT530867 TRUB1 TruB pseudouridine synthase family member 1 2 2
MIRT531832 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT533035 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT533165 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT533464 TRIM71 tripartite motif containing 71 2 2
MIRT534331 SHCBP1 SHC binding and spindle associated 1 2 2
MIRT539372 ADSS adenylosuccinate synthase 2 6
MIRT545951 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT553283 TSR1 TSR1, ribosome maturation factor 2 2
MIRT553532 TMEM185B transmembrane protein 185B 2 4
MIRT556480 LIPA lipase A, lysosomal acid type 2 2
MIRT556975 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT557697 GATA6 GATA binding protein 6 2 2
MIRT558901 CCDC58 coiled-coil domain containing 58 2 2
MIRT559224 BLMH bleomycin hydrolase 2 2
MIRT559827 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT563435 SLC3A2 solute carrier family 3 member 2 2 2
MIRT569270 PCDH11X protocadherin 11 X-linked 2 2
MIRT571386 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572567 AFF1 AF4/FMR2 family member 1 2 2
MIRT610400 AR androgen receptor 2 2
MIRT611058 ZNF621 zinc finger protein 621 2 2
MIRT635118 TMEM233 transmembrane protein 233 2 2
MIRT641617 DEFB118 defensin beta 118 2 2
MIRT642146 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT647295 C8orf33 chromosome 8 open reading frame 33 2 2
MIRT648155 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT652780 TENM3 teneurin transmembrane protein 3 2 2
MIRT657356 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT658718 ELN elastin 2 2
MIRT662441 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT665302 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT699898 RUNX1 runt related transcription factor 1 2 2
MIRT700921 PDS5A PDS5 cohesin associated factor A 2 2
MIRT700992 PDE3A phosphodiesterase 3A 2 2
MIRT707397 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT711895 INSIG2 insulin induced gene 2 2 2
MIRT712072 XRCC5 X-ray repair cross complementing 5 2 2
MIRT716121 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT724470 SMAD2 SMAD family member 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2115 Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-mir-2115 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-2115-3p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-2115-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-2115-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-2115-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-2115-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2115-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-2115-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission