pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4316 |
Genomic Coordinates | chr17: 77396984 - 77397054 |
Description | Homo sapiens miR-4316 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4316 | |||||||||
Sequence | 11| GGUGAGGCUAGCUGGUG |27 | |||||||||
Evidence | Experimental | |||||||||
Experiments | SOLiD | |||||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SMC4 | ||||||||||||||||||||
Synonyms | CAP-C, CAPC, SMC-4, SMC4L1 | ||||||||||||||||||||
Description | structural maintenance of chromosomes 4 | ||||||||||||||||||||
Transcript | NM_001002800 | ||||||||||||||||||||
Other Transcripts | NM_005496 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SMC4 | |||||||||||||||||||||
3'UTR of SMC4 (miRNA target sites are highlighted) |
>SMC4|NM_001002800|3'UTR 1 ACTTTATGCTGAAGATTCTTCAAGTTGATTCAGTGTATTACTGATTTTTTTCTATTTGTAAAGGATTATGAGTTGTATAA 81 AATACATACTCCCTAAACTAGATCATGAAACTGGTTTCTGTTTTATGCAGTTGTCATTTGTAAAGTCTAATAAAATATTC 161 TCTATAATTGCTTCTAGATTACAAAAATATGACAATCTTGTAAGTAGCAGACTATGGAGAAAAATGAGTTACCTGGAGGG 241 TCAGGTAACTTGCCAAACTAAAAAGTATGTTAGTTGAGGCAAAGTCCTAAGCAAGGTTGTGCTATCAAGGCTCAGCATAC 321 CTTCGTGGGCCTTTGATTTACCAACACTGGAAATGCCTGCCAACTAATCTTGGATAGATTCTTTAAGGCATTCCACTTAG 401 CTTGCCAGTTGAGACAATCACCACAGTTATTACCCAAATACTATGAACATATTTTTGTAAACCAGTCATTCTGAATTATA 481 GTGATGAGAATTTAAATATATGCTTTTCTAGAATTTGATGTTTGACCATTTATGACTTAATTACCAGAGAGCCAGTAAAT 561 TAGGACAGTGTTTCAACAAGCCTAGGCTATCTCGTAAGTTGAAAAATATCCCACTATAGTTGCTTCATGAGTATGAAGTA 641 AGATGGCCTCTGATTTACACTGGTTCAATTTACAAATTTTCAACTTTATGATAGGTTTATCCGGGTACTAAATGCATTTC 721 AACTTGATAGTTTCAACTTATGATAGGTTTACCAGGATGTAGTCCCACTGTTGAGGAGCATCTATTTAGGGGTTAATTAC 801 TTTAGTAATAAGTGGAAAGTAAGATACCTTGAGTAATGTTTGCCTATAAAATTGTCAGCGTATTTTTACACTATTGGCTC 881 AAGAATGTTATAATGCTAAGGGACATAAGTTGGCAACCACTTGGTTTTTGGAAGGACTTTCGGTATTGTATTAGAAGTCT 961 GCCCTAGCTGTTAAATTTCTGGGTATTTATCCTAAGGAATTAATTAAAGAGTTAATTGTTCCTTTCTTCAGTGGGCCATT 1041 GTTTTAGATATTTAAAAAATCCAACAGTTTCTATCATAATGTAACTGTAAAAATGTAAACACATTATTAGCATGGACTTT 1121 TAAATAAAGATTTAAAGAAAGCAAGATCGGAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Prostate Tissue | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000357388.3 | 3UTR | CUCACUGCAACCCUGCCUCAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
74 hsa-miR-4316 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT080624 | PMAIP1 | phorbol-12-myristate-13-acetate-induced protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT095088 | SEC24A | SEC24 homolog A, COPII coat complex component | ![]() |
![]() |
2 | 4 | ||||||
MIRT123331 | CALU | calumenin | ![]() |
![]() |
2 | 2 | ||||||
MIRT154964 | RRM2 | ribonucleotide reductase regulatory subunit M2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT370850 | TGFBR2 | transforming growth factor beta receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442955 | SGCD | sarcoglycan delta | ![]() |
![]() |
2 | 2 | ||||||
MIRT448240 | ZNF774 | zinc finger protein 774 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451710 | OLR1 | oxidized low density lipoprotein receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452072 | ATP6V0B | ATPase H+ transporting V0 subunit b | ![]() |
![]() |
2 | 2 | ||||||
MIRT455665 | GLO1 | glyoxalase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT460354 | TXNDC16 | thioredoxin domain containing 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461908 | NECAB3 | N-terminal EF-hand calcium binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462047 | HOXC13 | homeobox C13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462735 | EFNB1 | ephrin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463409 | ZC3HAV1L | zinc finger CCCH-type containing, antiviral 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT464952 | TWIST1 | twist family bHLH transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465052 | TSR1 | TSR1, ribosome maturation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT467549 | SMARCD1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT470226 | PRRC2A | proline rich coiled-coil 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT474081 | LMBR1L | limb development membrane protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT474481 | KLHDC8B | kelch domain containing 8B | ![]() |
![]() |
2 | 2 | ||||||
MIRT474704 | KIF3A | kinesin family member 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT474897 | KCTD21 | potassium channel tetramerization domain containing 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475203 | IL2RB | interleukin 2 receptor subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT477664 | EFHD2 | EF-hand domain family member D2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477775 | E2F3 | E2F transcription factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477940 | DPM2 | dolichyl-phosphate mannosyltransferase subunit 2, regulatory | ![]() |
![]() |
2 | 2 | ||||||
MIRT478224 | DDX52 | DExD-box helicase 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479904 | CCDC117 | coiled-coil domain containing 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480639 | BSCL2 | BSCL2, seipin lipid droplet biogenesis associated | ![]() |
![]() |
2 | 2 | ||||||
MIRT482435 | ADM | adrenomedullin | ![]() |
![]() |
2 | 10 | ||||||
MIRT483908 | GNB1L | G protein subunit beta 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT484161 | FAM71B | family with sequence similarity 71 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT484405 | SNX19 | sorting nexin 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485426 | LASP1 | LIM and SH3 protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489788 | KRT80 | keratin 80 | ![]() |
![]() |
2 | 4 | ||||||
MIRT490813 | ASB1 | ankyrin repeat and SOCS box containing 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT491176 | LAMA5 | laminin subunit alpha 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491573 | HSDL1 | hydroxysteroid dehydrogenase like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492633 | PLXNA1 | plexin A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492984 | NAV1 | neuron navigator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496441 | RAB11FIP4 | RAB11 family interacting protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT501829 | NCOA3 | nuclear receptor coactivator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT502165 | KIAA0195 | transmembrane protein 94 | ![]() |
![]() |
2 | 2 | ||||||
MIRT508652 | DIABLO | diablo IAP-binding mitochondrial protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT509554 | ACTG1 | actin gamma 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT520033 | YOD1 | YOD1 deubiquitinase | ![]() |
![]() |
2 | 6 | ||||||
MIRT523969 | DVL3 | dishevelled segment polarity protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526150 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530330 | ARHGAP1 | Rho GTPase activating protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539985 | SLC24A4 | solute carrier family 24 member 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT540851 | NUP155 | nucleoporin 155 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542326 | LIMD1 | LIM domains containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558908 | CBX5 | chromobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563663 | SMC4 | structural maintenance of chromosomes 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565433 | SURF4 | surfeit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567773 | DGAT2 | diacylglycerol O-acyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615573 | NCS1 | neuronal calcium sensor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627336 | TTLL7 | tubulin tyrosine ligase like 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632965 | EIF2S3 | eukaryotic translation initiation factor 2 subunit gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT634307 | SNTN | sentan, cilia apical structure protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT641569 | RAX | retina and anterior neural fold homeobox | ![]() |
![]() |
2 | 2 | ||||||
MIRT660509 | ARL5A | ADP ribosylation factor like GTPase 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT662703 | C10orf111 | chromosome 10 open reading frame 111 | ![]() |
![]() |
2 | 4 | ||||||
MIRT663214 | ZNF277 | zinc finger protein 277 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665318 | YIPF4 | Yip1 domain family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695264 | CD209 | CD209 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT696231 | LIN9 | lin-9 DREAM MuvB core complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT698867 | SRPR | SRP receptor alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT702700 | IPO9 | importin 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704236 | DHDDS | dehydrodolichyl diphosphate synthase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT704935 | CCDC120 | coiled-coil domain containing 120 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724285 | KCNMB1 | potassium calcium-activated channel subfamily M regulatory beta subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT735579 | VEGFA | vascular endothelial growth factor A | ![]() |
![]() |
![]() |
3 | 0 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|