>PPWD1|NM_015342|3'UTR
   1 AATAAGATTTGTTTTAATGTACTTGCAAATAAAAATACAATATTAAACAGATTATTTTACATTAGGAAGCTTAGGACTTG
  81 CTGAATATACAGATCATGTTTCAAAGATACAGTATTTTTGTATTTTTTATTAAAGGCTATTTTTTAAAAATTAAAAAAAA
 161 AAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gagUGGACUCGAGGGCACGGAc 5' |::|| :| :|| |:| Target 5' aagATTTGTTTTAATGTACTTg 3'	4 - 25	87.00	-9.30
2	miRNA 3' gaGUGGAC--UCGAG---GGCACGGac 5' ||:: | ||||: | |||: Target 5' taCATTAGGAAGCTTAGGACTTGCTga 3'	58 - 84	82.00	-9.00
3	miRNA 3' gagugGACUCGAGGGCACGGAc 5' | | :|:::|| ::| Target 5' agataCAGTATTTTTGTATTTt 3'	105 - 126	69.00	-8.00

Mutant ID	Mutant Position	Mutant Source
COSN31610439	18	COSMIC
COSN31578341	29	COSMIC
COSN5078366	56	COSMIC
COSN31567392	79	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs201905835	3	dbSNP
rs752108578	4	dbSNP
rs1181311769	6	dbSNP
rs1288226591	9	dbSNP
rs759235142	12	dbSNP
rs1370998297	21	dbSNP
rs1440967423	24	dbSNP
rs765606221	25	dbSNP
rs547411232	26	dbSNP
rs141224482	27	dbSNP
rs56156711	29	dbSNP
rs751626683	32	dbSNP
rs1219187406	37	dbSNP
rs1275981887	39	dbSNP
rs760037263	45	dbSNP
rs141493463	49	dbSNP
rs1344604407	51	dbSNP
rs757410553	52	dbSNP
rs781484900	53	dbSNP
rs769728460	71	dbSNP
rs958187706	84	dbSNP
rs1267925095	86	dbSNP
rs898388015	88	dbSNP
rs1331923085	93	dbSNP
rs1280206441	95	dbSNP
rs1447303491	105	dbSNP
rs975045765	107	dbSNP
rs1029676694	111	dbSNP
rs954954822	112	dbSNP
rs372665206	116	dbSNP
rs1453694626	123	dbSNP
rs1406504168	132	dbSNP
rs1158210111	136	dbSNP
rs1455564086	140	dbSNP
rs1410155808	146	dbSNP
rs987551240	147	dbSNP
rs1232983639	152	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.