miRTarBase - #MIRT564402


—
pre-miRNA Information
pre-miRNA hsa-let-7e   
Genomic Coordinates chr19: 51692786 - 51692864
Synonyms MIRNLET7E, hsa-let-7e, let-7e, MIRLET7E
Description Homo sapiens let-7e stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-let-7e-5p
Sequence 8| UGAGGUAGGAGGUUGUAUAGUU |29
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1189776118 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol EMILIN2   
Synonyms EMILIN-2, FOAP-10
Description elastin microfibril interfacer 2
Transcript NM_032048   
Expression
Putative miRNA Targets on EMILIN2
3'UTR of EMILIN2
(miRNA target sites are highlighted)		 
>EMILIN2|NM_032048|3'UTR
   1 GGTGGCTGGGGAGATGTCAGGGGAAAGATAGATAGTTGTAAAAACTCTAAAGCTTTAATATATTCGGTTTGTATGTAATG
  81 GAAGCACGGGGCTAGAGTTTCCACATAGGCCCCAACATAAAGGCCTTCCCTCGCTGTTGAGGCCACCATGCCTTACTGCA
 161 TCCAGCCAGGCTGCAGGGAGTGAGGCACACGGTGAACATGGCCACTGACTTTTCTGCCACTCTAACTGGACAACTGGAAG
 241 ACTTGGAAAGGCCTCCACCTGTATCTACACTCTGAGGGCCCTGGACTGGGCCTGAGCTTGCCACAGAGGCTCCGTCTGAC
 321 TGTGGGCTGGGAGGAGGGAGGCAGGGGAGAGCCGGTCACGGTGGCTGGTCTTTACTGCAGGGCAGCACTGTGGCCAGCTG
 401 TCTGTCTTTACACTGCATGCAGAAGTTTAAACACTGAAGTGCCGAAGTGGCCCGTGCCGCCGCACAGAGACCCCGACTTT
 481 AGTTTGGGCTGTTCCACGCTTGGCTCACCATTGCCGCCTGGGACTTAACCTGCTCAGGCGGGCCTTCGCCCAGCTGCAAA
 561 TAGGGATGCGTTAGAGACTGTTCCCAAAGCTTGTTGGGCTCCTTAAATGGCATGTACAATTTAAGTGCAAAGACAGGGAG
 641 TGTCAATAAAGATGGAAAGCCATTTCCAGTTAACTTTTGTTAATTTAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uugauauGUUGGA---GGAUG-GAGu 5'
                 | ||||   :|||| ||| 
Target 5' aaggcctCCACCTGTATCTACACTCt 3'
 248 - 273 119.00 -12.55
2 
miRNA  3' uuGAUAU--GUUGGAGGAUGGAGu 5'
            ||:|:  ||:|: :||::||: 
Target 5' caCTGTGGCCAGCTGTCTGTCTTt 3'
 386 - 409 114.00 -15.40
3 
miRNA  3' uugaUAUGUUGGAGGAUGGAGu 5'
              ||| |: | |:| |||| 
Target 5' caacATAAAGGC-CTTCCCTCg 3'
 113 - 133 109.00 -13.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28769314 30 COSMIC
COSN18716146 33 COSMIC
COSN31521739 473 COSMIC
COSN28663035 495 COSMIC
COSN28726405 646 COSMIC
COSN20114617 674 COSMIC
COSN23273863 1203 COSMIC
COSN6119144 1682 COSMIC
COSN8249867 2031 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1245739071 2 dbSNP
rs184522221 4 dbSNP
rs1489814466 5 dbSNP
rs751690646 8 dbSNP
rs780411691 9 dbSNP
rs1269199480 10 dbSNP
rs747447034 11 dbSNP
rs1293544648 12 dbSNP
rs769402513 12 dbSNP
rs775193240 13 dbSNP
rs748785731 18 dbSNP
rs755074676 19 dbSNP
rs1485272534 20 dbSNP
rs1185743880 21 dbSNP
rs768100233 23 dbSNP
rs1368234406 24 dbSNP
rs202229024 26 dbSNP
rs773920256 28 dbSNP
rs761617239 29 dbSNP
rs1790994 30 dbSNP
rs754013212 32 dbSNP
rs772862945 33 dbSNP
rs573555793 34 dbSNP
rs757444140 39 dbSNP
rs933824794 41 dbSNP
rs911944815 45 dbSNP
rs138887813 47 dbSNP
rs553192317 48 dbSNP
rs754054485 49 dbSNP
rs573096089 54 dbSNP
rs935469731 57 dbSNP
rs914065655 59 dbSNP
rs1274368713 63 dbSNP
rs1266440237 67 dbSNP
rs1177514919 68 dbSNP
rs1481580047 74 dbSNP
rs1256155228 77 dbSNP
rs370545739 80 dbSNP
rs946904838 82 dbSNP
rs1344904934 83 dbSNP
rs1043981989 88 dbSNP
rs1280104696 89 dbSNP
rs1231372942 91 dbSNP
rs545186810 92 dbSNP
rs1308175444 97 dbSNP
rs926880104 98 dbSNP
rs1189895287 106 dbSNP
rs111796189 107 dbSNP
rs1331319783 113 dbSNP
rs1475150144 116 dbSNP
rs1187162624 117 dbSNP
rs1056149167 119 dbSNP
rs1177906898 127 dbSNP
rs1421682480 129 dbSNP
rs896196088 133 dbSNP
rs893838560 134 dbSNP
rs1172867613 137 dbSNP
rs377554526 143 dbSNP
rs1177976772 145 dbSNP
rs530895446 148 dbSNP
rs1245061068 155 dbSNP
rs1461678807 155 dbSNP
rs1011097759 159 dbSNP
rs1023861788 166 dbSNP
rs149386560 169 dbSNP
rs1436344785 172 dbSNP
rs601071 178 dbSNP
rs117830416 187 dbSNP
rs1430884454 191 dbSNP
rs112072041 192 dbSNP
rs1338143045 205 dbSNP
rs1393860444 210 dbSNP
rs752432545 223 dbSNP
rs1158834293 228 dbSNP
rs982580309 229 dbSNP
rs1454991512 232 dbSNP
rs1378281399 235 dbSNP
rs1157772074 236 dbSNP
rs1232744851 236 dbSNP
rs1280172267 238 dbSNP
rs1016992016 244 dbSNP
rs1202513866 245 dbSNP
rs1282481753 246 dbSNP
rs1446660787 248 dbSNP
rs1185322462 249 dbSNP
rs1216723169 250 dbSNP
rs1441972301 253 dbSNP
rs1249988187 254 dbSNP
rs1452598274 255 dbSNP
rs757961204 259 dbSNP
rs1192999311 261 dbSNP
rs1395603382 262 dbSNP
rs1455449733 263 dbSNP
rs1487403503 264 dbSNP
rs1285770544 265 dbSNP
rs1247094409 266 dbSNP
rs1362039787 270 dbSNP
rs953973305 271 dbSNP
rs1339403861 275 dbSNP
rs962388038 283 dbSNP
rs975298816 284 dbSNP
rs750478544 291 dbSNP
rs560826792 309 dbSNP
rs1401482722 313 dbSNP
rs933773931 314 dbSNP
rs754952094 315 dbSNP
rs1425139299 317 dbSNP
rs1367191474 321 dbSNP
rs1319804175 348 dbSNP
rs71356081 348 dbSNP
rs1472404285 354 dbSNP
rs1391667259 355 dbSNP
rs1018899896 360 dbSNP
rs966476186 361 dbSNP
rs988231034 362 dbSNP
rs924504058 369 dbSNP
rs1439502903 381 dbSNP
rs935401983 384 dbSNP
rs1490957750 398 dbSNP
rs1288127952 399 dbSNP
rs1303366840 403 dbSNP
rs1209800033 406 dbSNP
rs1340611185 412 dbSNP
rs913998178 414 dbSNP
rs1219863495 415 dbSNP
rs968221053 418 dbSNP
rs1277241694 422 dbSNP
rs12963326 433 dbSNP
rs1372337425 441 dbSNP
rs532738075 445 dbSNP
rs1404708319 450 dbSNP
rs192937633 454 dbSNP
rs752543389 455 dbSNP
rs1464191190 457 dbSNP
rs1224558853 459 dbSNP
rs1270241379 460 dbSNP
rs1045248755 462 dbSNP
rs905448333 463 dbSNP
rs1198523856 466 dbSNP
rs185099108 470 dbSNP
rs1057020263 475 dbSNP
rs887304873 476 dbSNP
rs1315577959 481 dbSNP
rs1004346000 491 dbSNP
rs1223773351 494 dbSNP
rs1059281 495 dbSNP
rs189039864 498 dbSNP
rs1435585093 499 dbSNP
rs1333342527 500 dbSNP
rs996517402 516 dbSNP
rs1059282 517 dbSNP
rs955267511 521 dbSNP
rs1177178286 522 dbSNP
rs1470356535 531 dbSNP
rs536236477 540 dbSNP
rs1172208879 541 dbSNP
rs1470750480 545 dbSNP
rs1351178170 548 dbSNP
rs1036762925 549 dbSNP
rs552741254 557 dbSNP
rs573153856 564 dbSNP
rs1237048675 566 dbSNP
rs1203672098 569 dbSNP
rs1313437820 570 dbSNP
rs573071343 571 dbSNP
rs867590608 572 dbSNP
rs1049554797 573 dbSNP
rs538583138 576 dbSNP
rs1351185053 577 dbSNP
rs1326024063 585 dbSNP
rs1395984413 589 dbSNP
rs889657635 593 dbSNP
rs770567092 595 dbSNP
rs915336762 597 dbSNP
rs879945039 608 dbSNP
rs1450372512 614 dbSNP
rs1357487580 615 dbSNP
rs1333814030 618 dbSNP
rs1045034641 626 dbSNP
rs751113376 635 dbSNP
rs553578752 638 dbSNP
rs1401470523 639 dbSNP
rs1382584864 649 dbSNP
rs926653597 652 dbSNP
rs558442635 660 dbSNP
rs1008091982 664 dbSNP
rs369318618 671 dbSNP
rs11342330 672 dbSNP
rs397726418 672 dbSNP
rs1290481785 676 dbSNP
rs1332922703 679 dbSNP
rs569025618 680 dbSNP
rs1273922112 681 dbSNP
rs535573816 690 dbSNP
rs1184100926 694 dbSNP
rs11664722 695 dbSNP
rs1235214576 704 dbSNP
rs117836063 708 dbSNP
rs561391888 709 dbSNP
rs968544749 730 dbSNP
rs1352705885 732 dbSNP
rs1274231348 733 dbSNP
rs1038087052 734 dbSNP
rs979555610 740 dbSNP
rs1438249335 742 dbSNP
rs1033843583 759 dbSNP
rs761197063 763 dbSNP
rs1362622563 765 dbSNP
rs575336029 768 dbSNP
rs1242096962 772 dbSNP
rs1296578490 777 dbSNP
rs1419541252 781 dbSNP
rs1366563416 782 dbSNP
rs1167582365 783 dbSNP
rs1255076475 785 dbSNP
rs992394508 798 dbSNP
rs1180709012 803 dbSNP
rs1411029381 803 dbSNP
rs756534807 808 dbSNP
rs181859060 809 dbSNP
rs558072222 810 dbSNP
rs540615530 812 dbSNP
rs939675965 815 dbSNP
rs372572727 816 dbSNP
rs777006338 832 dbSNP
rs919648368 835 dbSNP
rs1369708718 837 dbSNP
rs1027980905 838 dbSNP
rs1223716972 842 dbSNP
rs1319803430 843 dbSNP
rs1460011357 844 dbSNP
rs1215310997 850 dbSNP
rs1289251605 850 dbSNP
rs532557364 853 dbSNP
rs1342438077 857 dbSNP
rs1166725736 860 dbSNP
rs955092060 861 dbSNP
rs1008540384 868 dbSNP
rs1031602837 871 dbSNP
rs761975301 873 dbSNP
rs1295607631 875 dbSNP
rs1456849521 876 dbSNP
rs889605208 880 dbSNP
rs989994334 880 dbSNP
rs555725015 889 dbSNP
rs1353913332 892 dbSNP
rs968089557 894 dbSNP
rs1294072345 895 dbSNP
rs868540486 897 dbSNP
rs943897934 910 dbSNP
rs754478300 911 dbSNP
rs1225329552 915 dbSNP
rs1191113032 920 dbSNP
rs980843574 921 dbSNP
rs1477268390 926 dbSNP
rs1267817704 927 dbSNP
rs1192644577 930 dbSNP
rs1487380300 936 dbSNP
rs926601312 939 dbSNP
rs1250729301 942 dbSNP
rs1199172560 943 dbSNP
rs1320150164 944 dbSNP
rs765469744 958 dbSNP
rs1057083228 960 dbSNP
rs1218280361 964 dbSNP
rs74485221 978 dbSNP
rs563181258 981 dbSNP
rs1009536756 982 dbSNP
rs1367325527 993 dbSNP
rs1038540254 1002 dbSNP
rs1299289184 1006 dbSNP
rs1277929601 1008 dbSNP
rs186422119 1009 dbSNP
rs548841926 1010 dbSNP
rs56330434 1011 dbSNP
rs1377912131 1012 dbSNP
rs1177775581 1020 dbSNP
rs1049524719 1022 dbSNP
rs1266374961 1025 dbSNP
rs1257827451 1028 dbSNP
rs1459000517 1051 dbSNP
rs1033791444 1052 dbSNP
rs535993771 1053 dbSNP
rs767506647 1056 dbSNP
rs1007904697 1059 dbSNP
rs540030634 1061 dbSNP
rs546561317 1062 dbSNP
rs1312017503 1063 dbSNP
rs1373107389 1068 dbSNP
rs1430988352 1071 dbSNP
rs566308690 1072 dbSNP
rs1011475347 1078 dbSNP
rs1021394078 1087 dbSNP
rs973050210 1090 dbSNP
rs969882430 1091 dbSNP
rs919580080 1092 dbSNP
rs1464198823 1094 dbSNP
rs752631587 1106 dbSNP
rs538267447 1107 dbSNP
rs1441475313 1110 dbSNP
rs1378472472 1112 dbSNP
rs1033776901 1117 dbSNP
rs1177914146 1121 dbSNP
rs1443123309 1124 dbSNP
rs143698988 1126 dbSNP
rs138235540 1131 dbSNP
rs1483019628 1132 dbSNP
rs142728351 1133 dbSNP
rs943844153 1134 dbSNP
rs1246128974 1142 dbSNP
rs1309237577 1142 dbSNP
rs554512382 1143 dbSNP
rs1314190722 1145 dbSNP
rs908572076 1160 dbSNP
rs1294985718 1162 dbSNP
rs940274078 1169 dbSNP
rs1298422691 1189 dbSNP
rs945951471 1190 dbSNP
rs574852493 1191 dbSNP
rs1158011712 1209 dbSNP
rs920069525 1216 dbSNP
rs1301140431 1218 dbSNP
rs932820348 1222 dbSNP
rs1370289832 1228 dbSNP
rs753627261 1234 dbSNP
rs1423464828 1238 dbSNP
rs1264245404 1240 dbSNP
rs1196088268 1242 dbSNP
rs1487536706 1244 dbSNP
rs756898775 1248 dbSNP
rs375536868 1257 dbSNP
rs560328914 1258 dbSNP
rs544408145 1262 dbSNP
rs1242069239 1264 dbSNP
rs560659532 1266 dbSNP
rs146033336 1278 dbSNP
rs1025563892 1283 dbSNP
rs1450732667 1288 dbSNP
rs1338181492 1292 dbSNP
rs1317312204 1298 dbSNP
rs371177418 1300 dbSNP
rs112898403 1301 dbSNP
rs994814456 1303 dbSNP
rs891477314 1304 dbSNP
rs1011423125 1308 dbSNP
rs1196160128 1309 dbSNP
rs201455503 1309 dbSNP
rs563168929 1310 dbSNP
rs532091222 1317 dbSNP
rs1177214919 1318 dbSNP
rs1021508636 1322 dbSNP
rs1199947683 1323 dbSNP
rs542419970 1324 dbSNP
rs562179883 1326 dbSNP
rs1361220597 1333 dbSNP
rs1333567307 1339 dbSNP
rs910936325 1341 dbSNP
rs1174234544 1342 dbSNP
rs370099821 1343 dbSNP
rs1269383207 1354 dbSNP
rs1001325774 1356 dbSNP
rs1332584881 1359 dbSNP
rs965101614 1364 dbSNP
rs1440030352 1365 dbSNP
rs976567685 1370 dbSNP
rs1172838092 1373 dbSNP
rs200028196 1375 dbSNP
rs3833198 1377 dbSNP
rs397703641 1377 dbSNP
rs749070754 1379 dbSNP
rs1419163362 1380 dbSNP
rs917055876 1384 dbSNP
rs1043344880 1386 dbSNP
rs929922336 1386 dbSNP
rs945927856 1386 dbSNP
rs1035971001 1387 dbSNP
rs1378023550 1388 dbSNP
rs960815034 1389 dbSNP
rs1198811785 1390 dbSNP
rs1323850928 1392 dbSNP
rs527903640 1393 dbSNP
rs139947172 1403 dbSNP
rs1271921032 1404 dbSNP
rs1015577419 1416 dbSNP
rs1219692173 1421 dbSNP
rs961381884 1425 dbSNP
rs566564033 1431 dbSNP
rs1314845996 1432 dbSNP
rs974296916 1443 dbSNP
rs111925522 1446 dbSNP
rs1377465911 1449 dbSNP
rs1465917777 1455 dbSNP
rs1211243305 1457 dbSNP
rs1251732643 1467 dbSNP
rs1046507030 1470 dbSNP
rs12967402 1471 dbSNP
rs994365363 1475 dbSNP
rs1027166151 1479 dbSNP
rs985616105 1482 dbSNP
rs1416339165 1486 dbSNP
rs1427711106 1492 dbSNP
rs912748287 1494 dbSNP
rs943792021 1495 dbSNP
rs568806601 1498 dbSNP
rs1417689231 1500 dbSNP
rs1006472427 1501 dbSNP
rs1382771351 1505 dbSNP
rs150781671 1508 dbSNP
rs912874717 1511 dbSNP
rs530823340 1514 dbSNP
rs976893558 1520 dbSNP
rs768755635 1521 dbSNP
rs1276253820 1523 dbSNP
rs1042921032 1527 dbSNP
rs967591010 1529 dbSNP
rs189357262 1530 dbSNP
rs925823016 1532 dbSNP
rs937240650 1532 dbSNP
rs1450477659 1534 dbSNP
rs769248763 1538 dbSNP
rs1056947411 1539 dbSNP
rs895667177 1543 dbSNP
rs776903162 1547 dbSNP
rs1016110411 1555 dbSNP
rs1157417174 1556 dbSNP
rs1406628192 1557 dbSNP
rs1181868412 1563 dbSNP
rs1473492231 1565 dbSNP
rs949437215 1566 dbSNP
rs1488519707 1574 dbSNP
rs961328188 1575 dbSNP
rs1214384233 1576 dbSNP
rs868362231 1577 dbSNP
rs995512982 1578 dbSNP
rs1316207417 1582 dbSNP
rs1290684406 1585 dbSNP
rs540606590 1590 dbSNP
rs762219462 1597 dbSNP
rs139138173 1599 dbSNP
rs773474838 1605 dbSNP
rs1231023674 1606 dbSNP
rs1292959957 1610 dbSNP
rs553937773 1612 dbSNP
rs912703345 1615 dbSNP
rs180682968 1616 dbSNP
rs79321443 1617 dbSNP
rs186172256 1618 dbSNP
rs576794409 1623 dbSNP
rs947172619 1624 dbSNP
rs1163795451 1625 dbSNP
rs546594766 1625 dbSNP
rs1042701516 1626 dbSNP
rs997877159 1626 dbSNP
rs1020424578 1630 dbSNP
rs1485418443 1631 dbSNP
rs1176961041 1632 dbSNP
rs967159952 1634 dbSNP
rs1223645518 1636 dbSNP
rs1320039755 1637 dbSNP
rs926986100 1643 dbSNP
rs149911768 1644 dbSNP
rs562425928 1647 dbSNP
rs1057423696 1650 dbSNP
rs1382075498 1658 dbSNP
rs751586735 1659 dbSNP
rs1368725008 1661 dbSNP
rs760635286 1662 dbSNP
rs1434885270 1663 dbSNP
rs1417269867 1664 dbSNP
rs8098776 1667 dbSNP
rs917190241 1668 dbSNP
rs1465824867 1670 dbSNP
rs1005124239 1671 dbSNP
rs541621831 1681 dbSNP
rs1425569754 1682 dbSNP
rs1427756642 1682 dbSNP
rs949384912 1683 dbSNP
rs559804798 1686 dbSNP
rs1199421629 1689 dbSNP
rs532119622 1691 dbSNP
rs1352028997 1693 dbSNP
rs1412553588 1697 dbSNP
rs1292278480 1699 dbSNP
rs551731211 1700 dbSNP
rs1226926520 1702 dbSNP
rs1313181195 1704 dbSNP
rs1026976603 1707 dbSNP
rs1229503210 1715 dbSNP
rs1370826471 1721 dbSNP
rs1310630004 1729 dbSNP
rs753624396 1734 dbSNP
rs1401816376 1738 dbSNP
rs888601506 1751 dbSNP
rs568545246 1753 dbSNP
rs531219966 1754 dbSNP
rs1177884358 1761 dbSNP
rs1484210786 1764 dbSNP
rs942893756 1771 dbSNP
rs140308336 1774 dbSNP
rs1441665096 1775 dbSNP
rs1039906456 1776 dbSNP
rs901436975 1779 dbSNP
rs1020290593 1782 dbSNP
rs1258142207 1789 dbSNP
rs1209267047 1790 dbSNP
rs965541736 1800 dbSNP
rs748238104 1802 dbSNP
rs1242912438 1806 dbSNP
rs1019947538 1817 dbSNP
rs3745013 1818 dbSNP
rs535177196 1819 dbSNP
rs968420562 1821 dbSNP
rs1032787988 1835 dbSNP
rs1304208183 1837 dbSNP
rs1432681186 1839 dbSNP
rs1374591053 1843 dbSNP
rs978510037 1846 dbSNP
rs1421383614 1849 dbSNP
rs1427882104 1851 dbSNP
rs1012768893 1854 dbSNP
rs1181098222 1857 dbSNP
rs926932037 1862 dbSNP
rs1424473468 1870 dbSNP
rs1169077018 1875 dbSNP
rs764874167 1880 dbSNP
rs1186052643 1881 dbSNP
rs899954827 1882 dbSNP
rs1432622618 1883 dbSNP
rs1311933740 1884 dbSNP
rs750115189 1885 dbSNP
rs917160406 1891 dbSNP
rs549105434 1895 dbSNP
rs1359354817 1896 dbSNP
rs1449700100 1898 dbSNP
rs1237773856 1912 dbSNP
rs1267926023 1915 dbSNP
rs940650826 1917 dbSNP
rs144153168 1926 dbSNP
rs899029135 1927 dbSNP
rs931359288 1928 dbSNP
rs758077109 1929 dbSNP
rs117523721 1940 dbSNP
rs889753353 1942 dbSNP
rs1007312153 1944 dbSNP
rs909986521 1945 dbSNP
rs1157919220 1955 dbSNP
rs147770694 1956 dbSNP
rs1370238070 1960 dbSNP
rs1474975244 1961 dbSNP
rs539973274 1961 dbSNP
rs1278249215 1964 dbSNP
rs1196377100 1975 dbSNP
rs1445621985 1977 dbSNP
rs1010511443 1979 dbSNP
rs755490008 1980 dbSNP
rs968870112 1981 dbSNP
rs1356472435 1984 dbSNP
rs1274447724 1985 dbSNP
rs1231084507 1987 dbSNP
rs8099778 1989 dbSNP
rs1448925875 1994 dbSNP
rs1278440333 1998 dbSNP
rs1189212936 1999 dbSNP
rs1034064007 2005 dbSNP
rs1317606522 2013 dbSNP
rs1391914031 2015 dbSNP
rs576478146 2016 dbSNP
rs542209117 2019 dbSNP
rs1323905519 2021 dbSNP
rs1460981656 2022 dbSNP
rs1042392594 2024 dbSNP
rs191044705 2025 dbSNP
rs1372824591 2039 dbSNP
rs999883879 2040 dbSNP
rs992894800 2047 dbSNP
rs1453769583 2048 dbSNP
rs1425553415 2052 dbSNP
rs1054176445 2054 dbSNP
rs1211357531 2056 dbSNP
rs572739315 2066 dbSNP
rs1258362538 2068 dbSNP
rs1197152272 2069 dbSNP
rs940583029 2072 dbSNP
rs1315722573 2073 dbSNP
rs1337239676 2073 dbSNP
rs1269328022 2085 dbSNP
rs683642 2086 dbSNP
rs621739 2089 dbSNP
rs1373186596 2099 dbSNP
rs1344154529 2104 dbSNP
rs894237997 2105 dbSNP
rs971990269 2109 dbSNP
rs1401082916 2111 dbSNP
rs1331162960 2112 dbSNP
rs920405082 2115 dbSNP
rs930467622 2116 dbSNP
rs1396239410 2117 dbSNP
rs11334875 2120 dbSNP
rs1173450357 2120 dbSNP
rs1193537281 2120 dbSNP
rs1206212134 2120 dbSNP
rs1238212336 2120 dbSNP
rs1453314793 2120 dbSNP
rs1479209011 2120 dbSNP
rs796720142 2120 dbSNP
rs1367948133 2121 dbSNP
rs1048475823 2124 dbSNP
rs1024140861 2129 dbSNP
rs971670753 2133 dbSNP
rs1233421362 2134 dbSNP
rs1349756238 2134 dbSNP
rs183408631 2134 dbSNP
rs1274666651 2135 dbSNP
rs1281294685 2136 dbSNP
rs1440292366 2137 dbSNP
rs1346073754 2140 dbSNP
rs993415222 2140 dbSNP
rs892606875 2141 dbSNP
rs1437027279 2145 dbSNP
rs889862094 2155 dbSNP
rs186012989 2158 dbSNP
rs1041426448 2159 dbSNP
rs1282418977 2167 dbSNP
rs1464532031 2169 dbSNP
rs901202951 2175 dbSNP
rs1010875914 2180 dbSNP
rs149230043 2181 dbSNP
rs904659441 2182 dbSNP
rs190829010 2183 dbSNP
rs1210090573 2184 dbSNP
rs909933980 2193 dbSNP
rs1286252803 2196 dbSNP
rs545456546 2205 dbSNP
rs770195042 2206 dbSNP
rs1285049890 2210 dbSNP
rs562263392 2212 dbSNP
rs183342874 2213 dbSNP
rs1406754459 2214 dbSNP
rs922783798 2218 dbSNP
rs557814001 2225 dbSNP
rs1401149092 2226 dbSNP
rs934178734 2227 dbSNP
rs113741570 2229 dbSNP
rs971937730 2233 dbSNP
rs368000713 2234 dbSNP
rs920520113 2236 dbSNP
rs951977753 2244 dbSNP
rs1439349262 2245 dbSNP
rs1475949141 2249 dbSNP
rs985959700 2250 dbSNP
rs1486062369 2251 dbSNP
rs548212283 2251 dbSNP
rs942766566 2252 dbSNP
rs1041147898 2255 dbSNP
rs1235385400 2263 dbSNP
rs368722592 2265 dbSNP
rs1328774552 2267 dbSNP
rs946052910 2269 dbSNP
rs1041917550 2271 dbSNP
rs1012662744 2272 dbSNP
rs28651233 2276 dbSNP
rs1209229823 2277 dbSNP
rs527611623 2280 dbSNP
rs1056347295 2281 dbSNP
rs1462552848 2283 dbSNP
rs894669327 2285 dbSNP
rs1014400450 2286 dbSNP
rs1428945675 2286 dbSNP
rs1453154549 2293 dbSNP
rs1179373379 2295 dbSNP
rs1475010695 2302 dbSNP
rs1024063967 2304 dbSNP
rs1026199768 2306 dbSNP
rs1215705526 2310 dbSNP
rs1250738035 2312 dbSNP
rs961981626 2319 dbSNP
rs12954254 2320 dbSNP
rs1309654580 2335 dbSNP
rs1415039752 2337 dbSNP
rs570627967 2339 dbSNP
rs975506694 2340 dbSNP
rs774451969 2342 dbSNP
rs1442523704 2345 dbSNP
rs1391615223 2359 dbSNP
rs550250793 2362 dbSNP
rs910348320 2363 dbSNP
rs1407528668 2371 dbSNP
rs759588707 2372 dbSNP
rs1167977014 2378 dbSNP
rs977202457 2383 dbSNP
rs570172137 2385 dbSNP
rs1410677919 2393 dbSNP
rs553656769 2396 dbSNP
rs1452691839 2399 dbSNP
rs377596608 2402 dbSNP
rs1178009503 2410 dbSNP
rs631459 2411 dbSNP
rs924818531 2412 dbSNP
rs1244123264 2415 dbSNP
rs936236902 2416 dbSNP
rs1358409260 2418 dbSNP
rs1368182491 2419 dbSNP
rs1041695776 2421 dbSNP
rs925977532 2422 dbSNP
rs1193965186 2433 dbSNP
rs1273658698 2435 dbSNP
rs915566855 2436 dbSNP
rs555778051 2438 dbSNP
rs1375794280 2439 dbSNP
rs572626627 2443 dbSNP
rs534038008 2449 dbSNP
rs761598859 2449 dbSNP
rs1206935098 2450 dbSNP
rs1394560711 2454 dbSNP
rs894599208 2456 dbSNP
rs1422779356 2463 dbSNP
rs1248743012 2467 dbSNP
rs372920669 2468 dbSNP
rs1369648070 2473 dbSNP
rs1474060052 2475 dbSNP
rs1209376917 2476 dbSNP
rs1014433828 2477 dbSNP
rs1167195445 2480 dbSNP
rs1370391687 2482 dbSNP
rs187732044 2483 dbSNP
rs765103946 2485 dbSNP
rs897576097 2486 dbSNP
rs993270644 2489 dbSNP
rs1408786100 2492 dbSNP
rs1355869266 2509 dbSNP
rs1400312379 2512 dbSNP
rs1027310806 2520 dbSNP
rs1412693289 2521 dbSNP
rs1395623280 2524 dbSNP
rs558043979 2526 dbSNP
rs750205110 2529 dbSNP
rs951705903 2531 dbSNP
rs1289351506 2542 dbSNP
rs1455445809 2543 dbSNP
rs1048022360 2544 dbSNP
rs577786478 2545 dbSNP
rs1342274715 2546 dbSNP
rs1186334761 2548 dbSNP
rs1225171978 2557 dbSNP
rs1007866310 2562 dbSNP
rs1207379121 2563 dbSNP
rs758167177 2564 dbSNP
rs1258370766 2581 dbSNP
rs1006083231 2590 dbSNP
rs1017500366 2592 dbSNP
rs1342659169 2598 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uugaUAUGUU-GGAGGAUGGAgu 5'
              | :||| :|||||||||  
Target 5' guucAAGCAAUUCUCCUACCU-- 3'
 		9 - 29
2 
miRNA  3' uugauauguuggaggauGGAGu 5'
                           |||| 
Target 5' -----------------CCUCc 3'
 		1 - 5
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293/HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells) ...

- Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology.

Article - Kishore S; Gruber AR; Jedlinski DJ; Syed et al.
- Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
CLIP-seq Support 1 for dataset GSM1067870
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (mitotic cells)
Location of target site ENST00000254528.3 | 3UTR | CAAGCAAUUCUCCUACCUCAGCCUCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000254528.3 | 3UTR | CCUCCCGGGUUCAAGCAAUUCUCCUACCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.518 0 0.576 0 49 Click to see details
LUSC 0.381 0.01 0.286 0.04 38 Click to see details
PRAD -0.291 0.02 -0.244 0.04 50 Click to see details
PCPG -0.996 0.03 -1.000 0.5 3 Click to see details
PAAD 0.875 0.06 0.800 0.1 4 Click to see details
CHOL 0.508 0.08 0.433 0.12 9 Click to see details
HNSC 0.216 0.08 0.266 0.04 42 Click to see details
CESC -0.94 0.11 -1.000 0.5 3 Click to see details
KIRP -0.2 0.14 -0.076 0.34 32 Click to see details
KIRC 0.113 0.18 0.158 0.1 68 Click to see details
LUAD -0.248 0.22 -0.140 0.33 12 Click to see details
UCEC -0.129 0.3 -0.058 0.41 19 Click to see details
KICH 0.059 0.39 0.035 0.43 25 Click to see details
COAD -0.114 0.39 -0.238 0.29 8 Click to see details
THCA -0.032 0.4 -0.050 0.35 59 Click to see details
ESCA -0.076 0.41 -0.127 0.35 11 Click to see details
BRCA 0.021 0.42 -0.009 0.47 84 Click to see details
BLCA 0.041 0.44 -0.034 0.45 18 Click to see details
STAD -0.007 0.48 -0.034 0.43 32 Click to see details
STAD -0.007 0.48 -0.034 0.43 32 Click to see details
STAD -0.007 0.48 -0.034 0.43 32 Click to see details
581 hsa-let-7e-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002081 HMGA2 high mobility group AT-hook 2 5 5
MIRT003932 EIF3J eukaryotic translation initiation factor 3 subunit J 2 1
MIRT004469 SMC1A structural maintenance of chromosomes 1A 4 7
MIRT005718 WNT1 Wnt family member 1 4 1
MIRT006122 CCND1 cyclin D1 5 4
MIRT006404 MPL MPL proto-oncogene, thrombopoietin receptor 1 1
MIRT032098 RABGAP1L RAB GTPase activating protein 1 like 1 1
MIRT032099 DAD1 defender against cell death 1 1 1
MIRT032100 MYCN MYCN proto-oncogene, bHLH transcription factor 4 2
MIRT051413 WDR67 TBC1 domain family member 31 1 1
MIRT051414 FAM219B family with sequence similarity 219 member B 1 1
MIRT051415 C11orf91 chromosome 11 open reading frame 91 1 1
MIRT051416 CENPP centromere protein P 1 1
MIRT051417 TMEM107 transmembrane protein 107 1 1
MIRT051418 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT051419 DAAM1 dishevelled associated activator of morphogenesis 1 1 1
MIRT051420 DGCR8 DGCR8, microprocessor complex subunit 1 1
MIRT051421 RAP1A RAP1A, member of RAS oncogene family 1 1
MIRT051422 RPA1 replication protein A1 1 1
MIRT051423 SKIV2L Ski2 like RNA helicase 1 1
MIRT051424 AGO1 argonaute 1, RISC catalytic component 4 2
MIRT051425 RPS27 ribosomal protein S27 1 1
MIRT051426 ARNT2 aryl hydrocarbon receptor nuclear translocator 2 1 1
MIRT051427 GPM6B glycoprotein M6B 1 1
MIRT051428 TTLL12 tubulin tyrosine ligase like 12 1 1
MIRT051429 HIST2H2BF histone cluster 2 H2B family member f 1 1
MIRT051430 CELF2 CUGBP Elav-like family member 2 1 1
MIRT051431 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT051432 VPS13D vacuolar protein sorting 13 homolog D 1 1
MIRT051433 RPL10 ribosomal protein L10 1 1
MIRT051434 SPCS2 signal peptidase complex subunit 2 1 1
MIRT051435 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT051436 CTC1 CST telomere replication complex component 1 1 1
MIRT051437 NAA60 N(alpha)-acetyltransferase 60, NatF catalytic subunit 1 1
MIRT051438 PHF3 PHD finger protein 3 1 1
MIRT051439 TUBA1B tubulin alpha 1b 1 1
MIRT051440 SHANK1 SH3 and multiple ankyrin repeat domains 1 1 1
MIRT051441 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT051442 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT051443 ND2 MTND2 1 1
MIRT051444 MED13L mediator complex subunit 13 like 1 1
MIRT051445 RCOR3 REST corepressor 3 1 1
MIRT051446 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT051447 RDX radixin 2 5
MIRT051448 PCBP2 poly(rC) binding protein 2 1 1
MIRT051449 UBAP2L ubiquitin associated protein 2 like 1 1
MIRT051450 CDCA3 cell division cycle associated 3 1 1
MIRT051451 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT051452 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 1
MIRT051453 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT051454 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT051455 WBSCR16 RCC1 like 1 1
MIRT051456 SLC2A11 solute carrier family 2 member 11 1 1
MIRT051457 NF1 neurofibromin 1 1 1
MIRT051458 LRRC8A leucine rich repeat containing 8 VRAC subunit A 1 1
MIRT051459 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT051460 DTNB dystrobrevin beta 1 1
MIRT051461 SCMH1 Scm polycomb group protein homolog 1 1 1
MIRT051462 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma 1 1
MIRT051463 RHBDD2 rhomboid domain containing 2 1 1
MIRT051464 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT051465 NDST1 N-deacetylase and N-sulfotransferase 1 1 1
MIRT051466 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 5
MIRT051467 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT051468 BAHCC1 BAH domain and coiled-coil containing 1 1 1
MIRT051469 CARM1 coactivator associated arginine methyltransferase 1 1 1
MIRT051470 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 1 1
MIRT051471 ND3 NADH dehydrogenase, subunit 3 (complex I) 1 1
MIRT051472 PIGS phosphatidylinositol glycan anchor biosynthesis class S 1 1
MIRT051473 ALG13 ALG13, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT051474 RPN2 ribophorin II 1 1
MIRT051475 RPL12 ribosomal protein L12 1 1
MIRT051476 NME4 NME/NM23 nucleoside diphosphate kinase 4 1 1
MIRT051477 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT051478 JAZF1 JAZF zinc finger 1 1 1
MIRT051479 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT051480 VARS valyl-tRNA synthetase 1 1
MIRT051481 RNF26 ring finger protein 26 1 1
MIRT051482 LHFPL2 LHFPL tetraspan subfamily member 2 1 1
MIRT051483 ARCN1 archain 1 1 1
MIRT051484 COX1 cytochrome c oxidase subunit I 1 1
MIRT051485 SLC12A4 solute carrier family 12 member 4 1 1
MIRT051486 AEBP2 AE binding protein 2 1 1
MIRT051487 PET112 glutamyl-tRNA amidotransferase subunit B 1 1
MIRT051488 UROC1 urocanate hydratase 1 1 1
MIRT051489 IGF1R insulin like growth factor 1 receptor 5 10
MIRT051490 BSDC1 BSD domain containing 1 1 1
MIRT051491 PTK2 protein tyrosine kinase 2 1 1
MIRT051492 CDC5L cell division cycle 5 like 1 1
MIRT051493 EN2 engrailed homeobox 2 1 1
MIRT051494 SSB Sjogren syndrome antigen B 1 1
MIRT051495 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT051496 RRAGC Ras related GTP binding C 1 1
MIRT051497 ZNF236 zinc finger protein 236 1 1
MIRT051498 SEMA4B semaphorin 4B 1 1
MIRT051499 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT051500 XIAP X-linked inhibitor of apoptosis 1 1
MIRT051501 GTF2I general transcription factor IIi 1 1
MIRT051502 JMJD1C jumonji domain containing 1C 1 1
MIRT051503 OTUD5 OTU deubiquitinase 5 1 1
MIRT051504 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT051505 PPIG peptidylprolyl isomerase G 1 1
MIRT051506 PSMD2 proteasome 26S subunit, non-ATPase 2 1 1
MIRT051507 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT051508 VAMP2 vesicle associated membrane protein 2 1 1
MIRT051509 LSR lipolysis stimulated lipoprotein receptor 1 1
MIRT051510 KIAA0355 KIAA0355 1 1
MIRT051511 RPSA ribosomal protein SA 1 1
MIRT051512 DCAF6 DDB1 and CUL4 associated factor 6 1 1
MIRT051513 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT051514 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT051515 PIGP phosphatidylinositol glycan anchor biosynthesis class P 1 1
MIRT051516 LMLN leishmanolysin like peptidase 1 1
MIRT051517 PPP2R1A protein phosphatase 2 scaffold subunit Aalpha 1 1
MIRT051518 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT051519 SERF2 small EDRK-rich factor 2 1 1
MIRT051520 RBM4 RNA binding motif protein 4 1 1
MIRT051521 RBM14 RNA binding motif protein 14 1 1
MIRT051522 HMGB1 high mobility group box 1 1 1
MIRT051523 GMPS guanine monophosphate synthase 1 1
MIRT051524 DIAPH1 diaphanous related formin 1 1 1
MIRT051525 STAM signal transducing adaptor molecule 1 1
MIRT051526 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT051527 APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 1 1
MIRT051528 MARCH5 membrane associated ring-CH-type finger 5 1 1
MIRT051529 SQLE squalene epoxidase 1 1
MIRT051530 TIMM50 translocase of inner mitochondrial membrane 50 1 1
MIRT051531 NDUFA3 NADH:ubiquinone oxidoreductase subunit A3 1 1
MIRT051532 NDUFS5 NADH:ubiquinone oxidoreductase subunit S5 1 1
MIRT051533 NRSN2 neurensin 2 1 1
MIRT051534 SALL1 spalt like transcription factor 1 1 1
MIRT051535 COX3 cytochrome c oxidase III 1 1
MIRT051536 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT051537 SUPT4H1 SPT4 homolog, DSIF elongation factor subunit 1 1
MIRT051538 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT051539 MTMR14 myotubularin related protein 14 1 1
MIRT051540 LUZP1 leucine zipper protein 1 1 1
MIRT051541 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT051542 SUZ12 SUZ12 polycomb repressive complex 2 subunit 1 1
MIRT051543 PAPD4 poly(A) RNA polymerase D4, non-canonical 1 1
MIRT051544 QSOX1 quiescin sulfhydryl oxidase 1 1 1
MIRT051545 SPATA13 spermatogenesis associated 13 1 1
MIRT051546 DHX57 DExH-box helicase 57 1 1
MIRT051547 KATNB1 katanin regulatory subunit B1 1 1
MIRT051548 COL6A1 collagen type VI alpha 1 chain 1 1
MIRT051549 DHX15 DEAH-box helicase 15 1 1
MIRT051550 MTCH2 mitochondrial carrier 2 1 1
MIRT051551 KIAA0100 KIAA0100 1 1
MIRT051552 SUGP2 SURP and G-patch domain containing 2 1 1
MIRT051553 NCLN nicalin 1 1
MIRT051554 ATXN2L ataxin 2 like 1 1
MIRT051555 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT051556 PES1 pescadillo ribosomal biogenesis factor 1 1 1
MIRT051557 NUP155 nucleoporin 155 2 7
MIRT051558 GNG5 G protein subunit gamma 5 2 3
MIRT051559 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT051560 MTFR1 mitochondrial fission regulator 1 1 1
MIRT051561 IRS2 insulin receptor substrate 2 2 1
MIRT051562 IRS4 insulin receptor substrate 4 1 1
MIRT051563 PPP1R10 protein phosphatase 1 regulatory subunit 10 1 1
MIRT051564 ZNF284 zinc finger protein 284 1 1
MIRT051565 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 1 1
MIRT051566 SCD stearoyl-CoA desaturase 1 1
MIRT051567 FDPS farnesyl diphosphate synthase 1 1
MIRT051568 KRBOX4 KRAB box domain containing 4 1 1
MIRT051569 BRI3 brain protein I3 1 1
MIRT051570 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT051571 PYCR1 pyrroline-5-carboxylate reductase 1 1 1
MIRT051572 SMAP2 small ArfGAP2 1 1
MIRT051573 WDFY3 WD repeat and FYVE domain containing 3 1 1
MIRT051574 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT051575 SRSF2 serine and arginine rich splicing factor 2 1 1
MIRT051576 PGD phosphogluconate dehydrogenase 1 1
MIRT051577 RMND5A required for meiotic nuclear division 5 homolog A 1 1
MIRT051578 ZNF652 zinc finger protein 652 1 1
MIRT051579 PSMA6 proteasome subunit alpha 6 1 1
MIRT051580 SLC38A2 solute carrier family 38 member 2 1 1
MIRT051581 LRRC41 leucine rich repeat containing 41 1 1
MIRT051582 RANBP2 RAN binding protein 2 1 1
MIRT051583 SVIL supervillin 1 1
MIRT051584 CCNG1 cyclin G1 1 1
MIRT051585 ZNF256 zinc finger protein 256 1 1
MIRT051586 COPG1 coatomer protein complex subunit gamma 1 1 1
MIRT051587 PDCD11 programmed cell death 11 1 1
MIRT051588 CNBP CCHC-type zinc finger nucleic acid binding protein 1 1
MIRT051589 USP37 ubiquitin specific peptidase 37 1 1
MIRT051590 UBE2V2 ubiquitin conjugating enzyme E2 V2 1 1
MIRT051591 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT051592 LMNA lamin A/C 1 1
MIRT051593 STAT3 signal transducer and activator of transcription 3 1 1
MIRT051594 TRPV1 transient receptor potential cation channel subfamily V member 1 1 1
MIRT051595 MATR3 matrin 3 1 1
MIRT051596 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT051597 HS6ST2 heparan sulfate 6-O-sulfotransferase 2 1 1
MIRT051598 WDR48 WD repeat domain 48 1 1
MIRT051599 RBM8A RNA binding motif protein 8A 1 1
MIRT051600 SCYL1 SCY1 like pseudokinase 1 1 1
MIRT051601 C19orf48 chromosome 19 open reading frame 48 1 1
MIRT051602 FOXD4L6 forkhead box D4 like 6 1 1
MIRT051603 PIGN phosphatidylinositol glycan anchor biosynthesis class N 1 1
MIRT051604 SPCS3 signal peptidase complex subunit 3 1 1
MIRT051605 TNFAIP1 TNF alpha induced protein 1 1 1
MIRT051606 MS4A10 membrane spanning 4-domains A10 1 1
MIRT051607 MSMO1 methylsterol monooxygenase 1 1 1
MIRT051608 ARID1A AT-rich interaction domain 1A 1 1
MIRT051609 NCKIPSD NCK interacting protein with SH3 domain 2 5
MIRT051610 NCBP1 nuclear cap binding protein subunit 1 1 1
MIRT051611 COX16 COX16, cytochrome c oxidase assembly homolog 1 1
MIRT051612 NUDT8 nudix hydrolase 8 1 1
MIRT051613 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT051614 TXNRD1 thioredoxin reductase 1 1 1
MIRT051615 ELMSAN1 ELM2 and Myb/SANT domain containing 1 1 1
MIRT051616 CTSA cathepsin A 1 1
MIRT051617 PRRC2A proline rich coiled-coil 2A 1 1
MIRT051618 SPAG9 sperm associated antigen 9 1 1
MIRT051619 AGMAT agmatinase 1 1
MIRT051620 NCKAP5L NCK associated protein 5 like 1 1
MIRT051621 ZFP62 ZFP62 zinc finger protein 1 1
MIRT051622 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT051623 POLR3D RNA polymerase III subunit D 2 3
MIRT051624 PRPF8 pre-mRNA processing factor 8 1 1
MIRT051625 ATP6 ATP synthase F0 subunit 6 1 1
MIRT051626 ZFAND5 zinc finger AN1-type containing 5 1 1
MIRT051627 BAZ1B bromodomain adjacent to zinc finger domain 1B 1 1
MIRT051628 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT051629 BMP2K BMP2 inducible kinase 1 1
MIRT051630 SPN sialophorin 1 1
MIRT051631 PA2G4 proliferation-associated 2G4 1 1
MIRT051632 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT051633 TUBB4B tubulin beta 4B class IVb 1 1
MIRT051634 TRRAP transformation/transcription domain associated protein 1 1
MIRT051635 SLCO4A1 solute carrier organic anion transporter family member 4A1 1 1
MIRT051636 CCRN4L nocturnin 1 1
MIRT051637 USE1 unconventional SNARE in the ER 1 1 1
MIRT051638 STARD7 StAR related lipid transfer domain containing 7 1 1
MIRT051639 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 3
MIRT051640 CLTC clathrin heavy chain 1 1
MIRT051641 TERF1 telomeric repeat binding factor 1 1 1
MIRT051642 PAX3 paired box 3 1 1
MIRT051643 CCDC97 coiled-coil domain containing 97 1 1
MIRT051644 HLA-C major histocompatibility complex, class I, C 1 1
MIRT051645 GTPBP8 GTP binding protein 8 (putative) 1 1
MIRT051646 VGLL4 vestigial like family member 4 1 1
MIRT051647 ANKRD40 ankyrin repeat domain 40 1 1
MIRT051648 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 1 1
MIRT051649 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT051650 DSP desmoplakin 1 1
MIRT051651 UBN2 ubinuclein 2 1 1
MIRT051652 ZNF805 zinc finger protein 805 1 1
MIRT051653 RBBP4 RB binding protein 4, chromatin remodeling factor 1 1
MIRT051654 OCLN occludin 1 1
MIRT051655 CBX5 chromobox 5 2 3
MIRT051656 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT051657 MKI67 marker of proliferation Ki-67 1 1
MIRT051658 SUB1 SUB1 homolog, transcriptional regulator 1 1
MIRT051659 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT051660 SEC23IP SEC23 interacting protein 1 1
MIRT051661 RNMT RNA guanine-7 methyltransferase 1 1
MIRT051662 SGSM3 small G protein signaling modulator 3 1 1
MIRT051663 ZFP3 ZFP3 zinc finger protein 1 1
MIRT051664 GLUL glutamate-ammonia ligase 1 1
MIRT051665 POLD1 DNA polymerase delta 1, catalytic subunit 1 1
MIRT051666 WDR4 WD repeat domain 4 1 1
MIRT051667 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT051668 RAI2 retinoic acid induced 2 1 1
MIRT051669 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 1 1
MIRT051670 UTP15 UTP15, small subunit processome component 1 1
MIRT051671 THADA THADA, armadillo repeat containing 1 1
MIRT051672 ZNF451 zinc finger protein 451 1 1
MIRT051673 CREBBP CREB binding protein 1 1
MIRT051674 ZNF770 zinc finger protein 770 1 1
MIRT051675 CLDN4 claudin 4 1 1
MIRT051676 ZKSCAN7 zinc finger with KRAB and SCAN domains 7 1 1
MIRT051677 NICN1 nicolin 1 1 1
MIRT051678 RPLP2 ribosomal protein lateral stalk subunit P2 1 1
MIRT051679 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT051680 IRGQ immunity related GTPase Q 1 1
MIRT051681 CA5B carbonic anhydrase 5B 1 1
MIRT051682 COX14 COX14, cytochrome c oxidase assembly factor 1 1
MIRT051683 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT051684 RPL27A ribosomal protein L27a 1 1
MIRT051685 CWC15 CWC15 spliceosome associated protein homolog 1 1
MIRT051686 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT051687 OR7D2 olfactory receptor family 7 subfamily D member 2 1 1
MIRT051688 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 1 1
MIRT051689 NUDT15 nudix hydrolase 15 1 1
MIRT051690 CDH18 cadherin 18 1 1
MIRT051691 FAM160B1 family with sequence similarity 160 member B1 1 1
MIRT051692 DZIP1 DAZ interacting zinc finger protein 1 1 1
MIRT051693 TDRD7 tudor domain containing 7 1 1
MIRT051694 TCF4 transcription factor 4 1 1
MIRT051695 ENSA endosulfine alpha 1 1
MIRT051696 GTF3C1 general transcription factor IIIC subunit 1 1 1
MIRT051697 TNFRSF1A TNF receptor superfamily member 1A 1 1
MIRT051698 CCDC113 coiled-coil domain containing 113 1 1
MIRT051699 MYO9B myosin IXB 1 1
MIRT051700 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 1 1
MIRT051701 PRAMEF13 PRAME family member 13 1 1
MIRT051702 PMPCA peptidase, mitochondrial processing alpha subunit 2 5
MIRT051703 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT051704 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT051705 CCDC106 coiled-coil domain containing 106 1 1
MIRT051706 CYP2B6 cytochrome P450 family 2 subfamily B member 6 1 1
MIRT051707 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 3
MIRT051708 PSME4 proteasome activator subunit 4 1 1
MIRT051709 SETD1A SET domain containing 1A 1 1
MIRT054561 MMP9 matrix metallopeptidase 9 3 1
MIRT054579 IGF1 insulin like growth factor 1 3 1
MIRT063195 ADIPOR2 adiponectin receptor 2 2 2
MIRT065687 ESPL1 extra spindle pole bodies like 1, separase 2 4
MIRT067399 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT068154 TXLNA taxilin alpha 2 2
MIRT068528 NHLRC3 NHL repeat containing 3 2 6
MIRT068789 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT073006 ARID3B AT-rich interaction domain 3B 2 6
MIRT076223 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT077616 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT080398 ONECUT2 one cut homeobox 2 2 2
MIRT083300 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT084976 BACH1 BTB domain and CNC homolog 1 2 2
MIRT094160 PCGF3 polycomb group ring finger 3 2 6
MIRT094460 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT095766 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT100094 ABT1 activator of basal transcription 1 2 8
MIRT112242 MDM4 MDM4, p53 regulator 2 4
MIRT118586 STK4 serine/threonine kinase 4 2 2
MIRT120921 PDE12 phosphodiesterase 12 2 8
MIRT123317 CALU calumenin 2 2
MIRT152272 TNFSF9 TNF superfamily member 9 2 2
MIRT153847 NCOA3 nuclear receptor coactivator 3 2 2
MIRT168583 HMGA1 high mobility group AT-hook 1 2 4
MIRT180603 CRY2 cryptochrome circadian clock 2 2 2
MIRT187717 SUOX sulfite oxidase 2 2
MIRT191404 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT193101 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT215720 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT218815 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT240330 UBXN2B UBX domain protein 2B 2 2
MIRT243473 TRIM71 tripartite motif containing 71 2 2
MIRT244069 EDN1 endothelin 1 2 2
MIRT252330 SALL3 spalt like transcription factor 3 2 2
MIRT255314 CDV3 CDV3 homolog 2 2
MIRT259277 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT259479 TXLNG taxilin gamma 2 2
MIRT260707 CLDN12 claudin 12 2 6
MIRT264693 C11ORF57 chromosome 11 open reading frame 57 2 4
MIRT266212 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT266626 CHTOP chromatin target of PRMT1 2 2
MIRT268839 C1ORF21 chromosome 1 open reading frame 21 2 2
MIRT294446 ZNF264 zinc finger protein 264 2 2
MIRT297013 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT297443 SLC20A1 solute carrier family 20 member 1 2 4
MIRT300037 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT300893 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT303320 MXD1 MAX dimerization protein 1 2 2
MIRT309846 NAT8L N-acetyltransferase 8 like 2 2
MIRT322428 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT324731 ACER2 alkaline ceramidase 2 2 2
MIRT402057 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT437395 LIN28A lin-28 homolog A 4 1
MIRT437396 AURKB aurora kinase B 4 1
MIRT437435 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 2 1
MIRT438632 TNFRSF10B TNF receptor superfamily member 10b 2 1
MIRT439135 MYC MYC proto-oncogene, bHLH transcription factor 0 1
MIRT442020 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT445658 ATP6V1G1 ATPase H+ transporting V1 subunit G1 2 6
MIRT447136 KIF27 kinesin family member 27 2 2
MIRT448259 ZNF774 zinc finger protein 774 2 2
MIRT449005 ANKRD46 ankyrin repeat domain 46 2 2
MIRT449953 FMNL3 formin like 3 2 2
MIRT451155 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451624 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451693 C1RL complement C1r subcomponent like 2 2
MIRT452092 NUCB2 nucleobindin 2 2 2
MIRT452431 QDPR quinoid dihydropteridine reductase 2 2
MIRT452943 DISC1 disrupted in schizophrenia 1 2 2
MIRT453401 RHD Rh blood group D antigen 2 6
MIRT454164 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT454280 FXN frataxin 2 2
MIRT454539 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT454854 ACOT9 acyl-CoA thioesterase 9 2 4
MIRT455676 GLO1 glyoxalase I 2 2
MIRT457248 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT457677 ZNF587 zinc finger protein 587 2 2
MIRT457887 THEM6 thioesterase superfamily member 6 2 4
MIRT458016 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT458279 FUT10 fucosyltransferase 10 2 2
MIRT459736 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT460453 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460500 FAM105A family with sequence similarity 105 member A 2 6
MIRT460938 NOA1 nitric oxide associated 1 2 4
MIRT461092 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT461169 SLC11A2 solute carrier family 11 member 2 2 4
MIRT461364 COL8A1 collagen type VIII alpha 1 chain 2 2
MIRT462382 YAE1D1 Yae1 domain containing 1 2 2
MIRT462780 ZNF8 zinc finger protein 8 2 2
MIRT463420 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463662 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464265 VCL vinculin 2 2
MIRT465122 TSC22D2 TSC22 domain family member 2 2 4
MIRT466184 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466722 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT469102 RNF144B ring finger protein 144B 2 2
MIRT469714 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT470425 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT470679 POLR2D RNA polymerase II subunit D 2 4
MIRT470861 PLXND1 plexin D1 2 2
MIRT471271 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT471957 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472672 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 2 2
MIRT472739 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473134 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT473234 SMCR7L mitochondrial elongation factor 1 1 4
MIRT473828 MAP2K7 mitogen-activated protein kinase kinase 7 2 2
MIRT473940 LYN LYN proto-oncogene, Src family tyrosine kinase 2 2
MIRT474022 LRRC20 leucine rich repeat containing 20 2 2
MIRT474502 KLHDC8B kelch domain containing 8B 2 2
MIRT474766 KIAA0930 KIAA0930 2 2
MIRT474905 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT475331 IFNLR1 interferon lambda receptor 1 2 2
MIRT475379 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT475733 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT476548 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT476973 FAM83G family with sequence similarity 83 member G 2 4
MIRT477534 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 2 4
MIRT477682 EFHD2 EF-hand domain family member D2 2 2
MIRT481201 ATXN7L3B ataxin 7 like 3B 2 4
MIRT481241 ATXN7L3 ataxin 7 like 3 2 2
MIRT481363 ATG9A autophagy related 9A 2 2
MIRT481388 ATG12 autophagy related 12 2 2
MIRT481652 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT481851 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT482184 AHR aryl hydrocarbon receptor 2 2
MIRT482220 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT485296 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT486659 ZNF28 zinc finger protein 28 2 2
MIRT489413 TUBB2A tubulin beta 2A class IIa 2 2
MIRT491867 ZBTB5 zinc finger and BTB domain containing 5 2 8
MIRT492216 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492626 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT493323 LIMD2 LIM domain containing 2 2 2
MIRT493901 FAM43A family with sequence similarity 43 member A 2 4
MIRT494263 CEP120 centrosomal protein 120 2 2
MIRT494687 ARID3A AT-rich interaction domain 3A 2 2
MIRT495968 TBC1D19 TBC1 domain family member 19 2 2
MIRT496111 SNX17 sorting nexin 17 2 2
MIRT497875 SLC12A7 solute carrier family 12 member 7 2 2
MIRT498122 PLEKHO1 pleckstrin homology domain containing O1 2 4
MIRT499405 PLCG2 phospholipase C gamma 2 2 4
MIRT499493 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 2
MIRT499653 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 2 2
MIRT499942 MFSD8 major facilitator superfamily domain containing 8 2 2
MIRT499997 HIST1H2BD histone cluster 1 H2B family member d 2 4
MIRT500819 THBS1 thrombospondin 1 2 3
MIRT500902 STRN striatin 2 4
MIRT501118 SLC5A6 solute carrier family 5 member 6 2 4
MIRT501173 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501202 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT501241 SEMA4C semaphorin 4C 2 6
MIRT501328 RNFT1 ring finger protein, transmembrane 1 2 2
MIRT501355 RNF44 ring finger protein 44 2 4
MIRT501387 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT501441 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT501759 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT501943 MBD2 methyl-CpG binding domain protein 2 2 8
MIRT502106 KPNA5 karyopherin subunit alpha 5 2 8
MIRT502130 KMT2D lysine methyltransferase 2D 2 4
MIRT502784 CEP135 centrosomal protein 135 2 2
MIRT502845 CELF1 CUGBP Elav-like family member 1 2 2
MIRT504789 C12orf4 chromosome 12 open reading frame 4 2 2
MIRT505017 ZNF644 zinc finger protein 644 2 2
MIRT506942 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT507252 FIGN fidgetin, microtubule severing factor 2 8
MIRT507694 COIL coilin 2 6
MIRT508401 C1orf210 chromosome 1 open reading frame 210 2 6
MIRT508665 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT508932 AK4 adenylate kinase 4 2 4
MIRT510395 ZNF566 zinc finger protein 566 2 6
MIRT510518 YOD1 YOD1 deubiquitinase 2 6
MIRT511386 IKZF3 IKAROS family zinc finger 3 2 4
MIRT512745 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT515954 C9orf156 tRNA methyltransferase O 2 2
MIRT516083 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 2 4
MIRT523619 FZD9 frizzled class receptor 9 2 4
MIRT523733 FBXW2 F-box and WD repeat domain containing 2 2 4
MIRT523990 DVL3 dishevelled segment polarity protein 3 2 2
MIRT524113 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT525727 SOD2 superoxide dismutase 2 2 2
MIRT527763 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT529727 OPRL1 opioid related nociceptin receptor 1 2 2
MIRT533187 WASL Wiskott-Aldrich syndrome like 2 6
MIRT536378 LEFTY1 left-right determination factor 1 2 2
MIRT543785 RBM12B RNA binding motif protein 12B 2 4
MIRT543868 SLC16A9 solute carrier family 16 member 9 2 2
MIRT545387 PM20D2 peptidase M20 domain containing 2 2 2
MIRT545890 ZNF200 zinc finger protein 200 2 4
MIRT546334 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547373 MSI2 musashi RNA binding protein 2 2 2
MIRT547579 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT548264 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548351 EPHA4 EPH receptor A4 2 2
MIRT548534 DUSP1 dual specificity phosphatase 1 2 2
MIRT548560 DNAL1 dynein axonemal light chain 1 2 2
MIRT548779 COLEC12 collectin subfamily member 12 2 2
MIRT548978 CCNT2 cyclin T2 2 2
MIRT549208 BEND4 BEN domain containing 4 2 4
MIRT549763 ZNF611 zinc finger protein 611 2 6
MIRT549799 KIAA0391 KIAA0391 2 2
MIRT549847 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT550898 ACTA1 actin, alpha 1, skeletal muscle 2 2
MIRT551283 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT551318 GSG2 histone H3 associated protein kinase 2 6
MIRT551932 AKAP8 A-kinase anchoring protein 8 2 4
MIRT552003 RAD18 RAD18, E3 ubiquitin protein ligase 2 2
MIRT552410 ZNF460 zinc finger protein 460 2 4
MIRT553013 USP38 ubiquitin specific peptidase 38 2 2
MIRT555550 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555711 PDZD8 PDZ domain containing 8 2 2
MIRT557372 HAND1 heart and neural crest derivatives expressed 1 2 2
MIRT557960 FAM222B family with sequence similarity 222 member B 2 2
MIRT559087 C19orf47 chromosome 19 open reading frame 47 2 4
MIRT559497 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT561772 PEG10 paternally expressed 10 2 2
MIRT564402 EMILIN2 elastin microfibril interfacer 2 2 4
MIRT565443 SURF4 surfeit 4 2 2
MIRT566518 PARP16 poly(ADP-ribose) polymerase family member 16 2 2
MIRT567715 E2F6 E2F transcription factor 6 2 2
MIRT568655 ABHD17C abhydrolase domain containing 17C 2 2
MIRT569498 THYN1 thymocyte nuclear protein 1 2 2
MIRT573820 TGOLN2 trans-golgi network protein 2 2 2
MIRT574363 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT574750 GOLGA4 golgin A4 2 2
MIRT574788 FAM104A family with sequence similarity 104 member A 2 2
MIRT576089 Poteg POTE ankyrin domain family, member G 2 2
MIRT576812 Thbs1 thrombospondin 1 2 3
MIRT616370 RWDD1 RWD domain containing 1 2 2
MIRT617851 FMO4 flavin containing monooxygenase 4 2 2
MIRT642394 ZNF556 zinc finger protein 556 2 2
MIRT680519 PRIM2 DNA primase subunit 2 2 2
MIRT680547 ZNF584 zinc finger protein 584 2 2
MIRT680800 ZNF578 zinc finger protein 578 2 2
MIRT680838 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT681141 INTS7 integrator complex subunit 7 2 2
MIRT681271 RFC2 replication factor C subunit 2 2 2
MIRT681323 ZFAND4 zinc finger AN1-type containing 4 2 4
MIRT681359 BRI3BP BRI3 binding protein 2 2
MIRT681506 STAT2 signal transducer and activator of transcription 2 2 2
MIRT681536 ZNF738 zinc finger protein 738 2 2
MIRT681658 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT681738 RAB19 RAB19, member RAS oncogene family 2 4
MIRT681797 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681869 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT681941 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682102 ITGA3 integrin subunit alpha 3 2 4
MIRT682181 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682238 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682384 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682444 MTX3 metaxin 3 2 2
MIRT682604 CPA4 carboxypeptidase A4 2 2
MIRT682640 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT689327 FPR1 formyl peptide receptor 1 2 2
MIRT689730 ATXN2 ataxin 2 2 2
MIRT691036 ZNF799 zinc finger protein 799 2 2
MIRT691935 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT694884 ZNF417 zinc finger protein 417 2 2
MIRT695255 ZNF443 zinc finger protein 443 2 2
MIRT695413 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT700589 PRSS22 protease, serine 22 2 2
MIRT701428 NHLRC2 NHL repeat containing 2 2 2
MIRT702484 KIAA1328 KIAA1328 2 2
MIRT702715 IPO9 importin 9 2 2
MIRT704028 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT704418 CTPS1 CTP synthase 1 2 2
MIRT705750 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT712373 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT713520 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT731263 FASLG Fas ligand 3 1
MIRT732697 Ccr7 chemokine (C-C motif) receptor 7 2 0
MIRT732700 Snhg12 small nucleolar RNA host gene 12 2 0
MIRT734626 SYT7 synaptotagmin 7 1 0
MIRT755829 UBQLN4 ubiquilin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
let-7e Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
let-7e Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
let-7e Doxorubicin approved 31703 Microarray ovarian cancer 19237188 2009 up-regulated
let-7e 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
let-7e Etoposide approved 36462 Microarray Normal human fibroblasts (AG01522) 19633716 2009 up-regulated
let-7e Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
let-7e 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
let-7e Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
let-7e Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
let-7e Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
let-7e 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
let-7e Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
let-7e Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
let-7e 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
let-7e Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-let-7e Doxorubicin 31703 NSC123127 approved resistant High Ovarian Cancer cell line (OV19, TOV21G, TOV112D, FUOV1, C13, OV2008, A2780CP, A2780S, IGROV1, T8, OVCAR5, IMCC3, A2008, OVCAR3, SKOV3, IOSER)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7e Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant High Tongue Squamous Cell Carcinoma cell line (Tca8113)
hsa-let-7e Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (DLD-1)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line (A2780)
hsa-let-7e Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-let-7e Paclitaxel 36314 NSC125973 approved sensitive High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-let-7e Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-let-7e Vincristine 5978 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-let-7e Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor tissue
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer tissue and cell line (MCF-7)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-let-7e Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7e Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (A2780, HO8910, ES2, CAOV3, SKOV3)
hsa-let-7e Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-8)
hsa-let-7e Daunorubicin 30323 NSC82151 approved resistant High Acute Promyelocytic Leukemia cell line (HL60)
hsa-let-7e Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7C)
hsa-let-7e Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7e Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (PC-9)
hsa-let-7e Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-let-7e Regorafenib 11167602 NSC763932 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-let-7e Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-let-7e Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-let-7e 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-let-7e Ethanol+Tamoxifen resistant cell line (LY2)
hsa-let-7e Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-let-7e Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-let-7e Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-let-7e Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-let-7e Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (OE19)
hsa-let-7e Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7e Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-let-7e Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-let-7e-5p Alvocidib 5287969 NSC649890 resistant
hsa-let-7e-5p Ethyl, methoxy, prodigisine 135829283 NSC742418 resistant
hsa-let-7e-5p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-let-7e-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7e-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-let-7e-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-let-7e-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-let-7e-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-let-7e-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-let-7e-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-let-7e-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-let-7e-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-let-7e-5p Sunitinib 5329102 NSC750690 approved sensitive tissue (clear cell renal cell carcinoma)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-let-7e-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)

Error report submission