miRTarBase - #MIRT567288


—
pre-miRNA Information
pre-miRNA hsa-mir-6819   
Genomic Coordinates chr22: 36286847 - 36286907
Description Homo sapiens miR-6819 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6819-3p
Sequence 41| AAGCCUCUGUCCCCACCCCAG |61
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1279530967 2 dbSNP
rs967579979 3 dbSNP
rs776891214 4 dbSNP
rs771166635 8 dbSNP
rs747037324 9 dbSNP
rs879248090 11 dbSNP
rs1485325191 12 dbSNP
rs778157316 16 dbSNP
Putative Targets

Gene Information
Gene Symbol HNRNPL   
Synonyms HNRPL, P/OKcl.14, hnRNP-L
Description heterogeneous nuclear ribonucleoprotein L
Transcript NM_001005335   
Other Transcripts NM_001533   
Expression
Putative miRNA Targets on HNRNPL
3'UTR of HNRNPL
(miRNA target sites are highlighted)		 
>HNRNPL|NM_001005335|3'UTR
   1 TTAGGTGCCTAGGAAGAGTCCCATCTGAGCAGGAAGACATTTCTCTTTCCTTTATGCCATTTTTTGTTTTTGTTATTTGC
  81 AAAAGATCTTGTATTCCTTTTTTTTTTTTTTTTTTTTTTTTTTAAATGCTAGGTTTGTAGAGGCTTACTTAACCTTAATG
 161 GAAACGCTGGAAATCTGCAGGGGGAGGGAGAGGGGAACTGTTATCTCCCAAGATTAACCTTCACTTTTAAAAAATTATTG
 241 TACATGTGATTTTTTTTTTTCCTGTTCATACATTTGTGCTGCCCATGTACTCTTGGCACATTTCAATAAAATTGTTTGGA
 321 AAATAAACACAGCAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaccCCACCCCUGUCUCCGAa 5'
              |||  |  :||||||| 
Target 5' gctaGGTTTG--TAGAGGCTt 3'
 128 - 146 145.00 -14.70
2 
miRNA  3' gaCCCCACCCCUGUCUCCgaa 5'
            |||| |||   |||||   
Target 5' agGGGGAGGG---AGAGGgga 3'
 179 - 196 120.00 -26.50
3 
miRNA  3' gaccCCAC---CCCUGUCUCCGaa 5'
              ||||    ||| |||| |  
Target 5' -ttaGGTGCCTAGGA-AGAGTCcc 3'
 1 - 22 100.00 -9.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30516303 16 COSMIC
COSN30487939 21 COSMIC
COSN30535672 26 COSMIC
COSN30153223 43 COSMIC
COSN30463834 53 COSMIC
COSN31492295 60 COSMIC
COSN19656335 66 COSMIC
COSN20093593 72 COSMIC
COSN28887212 85 COSMIC
COSN20093592 88 COSMIC
COSN13803616 91 COSMIC
COSN5268559 91 COSMIC
COSN20093590 93 COSMIC
COSN19661848 96 COSMIC
COSN29072803 97 COSMIC
COSN30465231 129 COSMIC
COSN30104994 149 COSMIC
COSN9357038 181 COSMIC
COSN17933560 185 COSMIC
COSN31584560 231 COSMIC
COSN31486103 232 COSMIC
COSN31550715 283 COSMIC
COSN29462482 287 COSMIC
COSN31529694 290 COSMIC
COSN29462285 293 COSMIC
COSN31575975 303 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs749444388 1 dbSNP
rs780270244 2 dbSNP
rs1336237812 5 dbSNP
rs756455071 7 dbSNP
rs543437858 8 dbSNP
rs757756862 10 dbSNP
rs778217185 13 dbSNP
rs770883447 14 dbSNP
rs752245729 17 dbSNP
rs1052831 25 dbSNP
rs1185357418 26 dbSNP
rs764910130 27 dbSNP
rs753172216 32 dbSNP
rs886950310 36 dbSNP
rs1048188064 37 dbSNP
rs931074685 38 dbSNP
rs754543185 43 dbSNP
rs776208844 47 dbSNP
rs1177525869 59 dbSNP
rs377050529 66 dbSNP
rs894661746 66 dbSNP
rs373027911 72 dbSNP
rs369024340 75 dbSNP
rs576507653 76 dbSNP
rs1297379717 79 dbSNP
rs1346027808 80 dbSNP
rs1388459306 81 dbSNP
rs561196071 85 dbSNP
rs1299175041 86 dbSNP
rs1455922556 87 dbSNP
rs374782235 88 dbSNP
rs572631534 91 dbSNP
rs371519765 93 dbSNP
rs1388734302 96 dbSNP
rs1448426465 97 dbSNP
rs898075972 99 dbSNP
rs943745523 116 dbSNP
rs1267272404 117 dbSNP
rs1189601547 120 dbSNP
rs1490863562 121 dbSNP
rs1269611173 122 dbSNP
rs912220759 123 dbSNP
rs1036731071 124 dbSNP
rs1157763955 124 dbSNP
rs1223246207 124 dbSNP
rs1238268086 124 dbSNP
rs1264184842 124 dbSNP
rs1291677822 124 dbSNP
rs1308878808 124 dbSNP
rs1310117145 124 dbSNP
rs1322694671 124 dbSNP
rs1365945931 124 dbSNP
rs1379306350 124 dbSNP
rs1386234055 124 dbSNP
rs1389987173 124 dbSNP
rs1425307271 124 dbSNP
rs1437471012 124 dbSNP
rs1459307439 124 dbSNP
rs35433653 124 dbSNP
rs397783343 124 dbSNP
rs1491375055 125 dbSNP
rs1367780340 127 dbSNP
rs765645636 127 dbSNP
rs1332059547 130 dbSNP
rs1402534188 132 dbSNP
rs1229297953 134 dbSNP
rs939688093 134 dbSNP
rs978082392 137 dbSNP
rs1330896645 139 dbSNP
rs1380233978 141 dbSNP
rs967613621 145 dbSNP
rs1300521557 147 dbSNP
rs1230343059 152 dbSNP
rs1311071665 154 dbSNP
rs912190390 156 dbSNP
rs1219766737 158 dbSNP
rs1260618070 165 dbSNP
rs186501702 166 dbSNP
rs990303654 175 dbSNP
rs547839569 178 dbSNP
rs1484046982 179 dbSNP
rs1179833591 180 dbSNP
rs986973751 183 dbSNP
rs1478060173 185 dbSNP
rs1172728485 189 dbSNP
rs1421441684 193 dbSNP
rs1464110560 204 dbSNP
rs1169862028 206 dbSNP
rs1359926367 213 dbSNP
rs958848997 216 dbSNP
rs112983660 219 dbSNP
rs1378891912 229 dbSNP
rs181457960 232 dbSNP
rs921124387 235 dbSNP
rs989940737 237 dbSNP
rs957318696 238 dbSNP
rs1278719074 243 dbSNP
rs112381348 249 dbSNP
rs1313525510 251 dbSNP
rs80103467 260 dbSNP
rs1031558850 261 dbSNP
rs1185939139 261 dbSNP
rs1488477163 261 dbSNP
rs35971309 261 dbSNP
rs879655165 261 dbSNP
rs77622416 262 dbSNP
rs1425979479 272 dbSNP
rs1014899328 273 dbSNP
rs1174177762 274 dbSNP
rs1416307406 274 dbSNP
rs1375118002 290 dbSNP
rs1420635575 294 dbSNP
rs1300466088 296 dbSNP
rs868335520 301 dbSNP
rs1339004331 306 dbSNP
rs1377363620 312 dbSNP
rs1430657945 318 dbSNP
rs1276019964 319 dbSNP
rs1174578360 333 dbSNP
rs977327143 336 dbSNP
rs1004540315 339 dbSNP
rs752091119 346 dbSNP
rs1024283255 347 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000221419.5 | 3UTR | CUUACUUAACCUUAAUGGAAACGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-6819-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT358318 PANK3 pantothenate kinase 3 2 2
MIRT454719 UBQLNL ubiquilin like 2 2
MIRT471362 PEG10 paternally expressed 10 2 2
MIRT478101 DLG5 discs large MAGUK scaffold protein 5 2 4
MIRT495554 GOLGA6L4 golgin A6 family-like 4 2 2
MIRT495587 GOLGA6L10 golgin A6 family-like 10 2 2
MIRT508315 RPL18 ribosomal protein L18 2 4
MIRT529183 ADAM33 ADAM metallopeptidase domain 33 2 2
MIRT532035 FHDC1 FH2 domain containing 1 2 2
MIRT545131 ANXA5 annexin A5 2 2
MIRT567288 HNRNPL heterogeneous nuclear ribonucleoprotein L 2 2
MIRT568094 CEBPG CCAAT/enhancer binding protein gamma 2 2
MIRT573291 DLX4 distal-less homeobox 4 2 2
MIRT575169 Fam120c family with sequence similarity 120, member C 2 2
MIRT609495 DNASE1L3 deoxyribonuclease 1 like 3 2 2
MIRT611264 EHD3 EH domain containing 3 2 2
MIRT613580 POC5 POC5 centriolar protein 2 2
MIRT616520 C9orf170 chromosome 9 open reading frame 170 2 2
MIRT617098 ZNF667 zinc finger protein 667 2 2
MIRT618268 DDX51 DEAD-box helicase 51 2 2
MIRT618294 ZNF682 zinc finger protein 682 2 2
MIRT618617 SHOX short stature homeobox 2 2
MIRT619741 SRFBP1 serum response factor binding protein 1 2 2
MIRT619784 NRIP2 nuclear receptor interacting protein 2 2 2
MIRT621119 SP110 SP110 nuclear body protein 2 2
MIRT622530 RAD51 RAD51 recombinase 2 2
MIRT623088 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT623938 FKBP14 FK506 binding protein 14 2 2
MIRT624389 CD84 CD84 molecule 2 2
MIRT624860 ABI2 abl interactor 2 2 2
MIRT628752 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT632243 VTA1 vesicle trafficking 1 2 2
MIRT632987 E2F2 E2F transcription factor 2 2 2
MIRT633695 RBM43 RNA binding motif protein 43 2 2
MIRT633766 CENPBD1 CENPB DNA-binding domain containing 1 2 2
MIRT633808 ZNF91 zinc finger protein 91 2 2
MIRT638914 CBLN2 cerebellin 2 precursor 2 2
MIRT641298 SLAMF1 signaling lymphocytic activation molecule family member 1 2 2
MIRT642123 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT642179 HEBP2 heme binding protein 2 2 2
MIRT642617 CDKN3 cyclin dependent kinase inhibitor 3 2 2
MIRT643325 TMEM151B transmembrane protein 151B 2 2
MIRT644534 TMEM134 transmembrane protein 134 2 2
MIRT645820 OMA1 OMA1 zinc metallopeptidase 2 2
MIRT646093 MGST3 microsomal glutathione S-transferase 3 2 2
MIRT646861 SLC35E4 solute carrier family 35 member E4 2 2
MIRT647466 DZIP1L DAZ interacting zinc finger protein 1 like 2 2
MIRT647702 NADSYN1 NAD synthetase 1 2 2
MIRT648082 ZMIZ2 zinc finger MIZ-type containing 2 2 2
MIRT648547 TMEM169 transmembrane protein 169 2 2
MIRT648690 AP1M1 adaptor related protein complex 1 mu 1 subunit 2 2
MIRT649747 GNB5 G protein subunit beta 5 2 2
MIRT650154 ZNF426 zinc finger protein 426 2 2
MIRT650450 CPXM2 carboxypeptidase X, M14 family member 2 2 2
MIRT650943 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT651544 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT652304 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT652890 SYVN1 synoviolin 1 2 2
MIRT654222 RNF19B ring finger protein 19B 2 2
MIRT654676 PSMB5 proteasome subunit beta 5 2 2
MIRT658249 FAXC failed axon connections homolog 2 2
MIRT658363 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT659622 CELF1 CUGBP Elav-like family member 1 2 2
MIRT660171 BNIP3L BCL2 interacting protein 3 like 2 2
MIRT660634 ANKRD52 ankyrin repeat domain 52 2 2
MIRT662428 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT662984 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT663939 ZNF554 zinc finger protein 554 2 2
MIRT666960 PKHD1 PKHD1, fibrocystin/polyductin 2 2
MIRT667945 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 2
MIRT668847 CYCS cytochrome c, somatic 2 2
MIRT671792 RGS17 regulator of G protein signaling 17 2 2
MIRT672382 RPL37 ribosomal protein L37 2 2
MIRT673516 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 4
MIRT674716 FAM73A mitoguardin 1 2 2
MIRT676352 KLF8 Kruppel like factor 8 2 2
MIRT677820 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT678440 PDE4C phosphodiesterase 4C 2 2
MIRT678499 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT679243 LRP10 LDL receptor related protein 10 2 2
MIRT693607 SLC39A1 solute carrier family 39 member 1 2 2
MIRT695927 ZNF174 zinc finger protein 174 2 2
MIRT697987 TSPAN6 tetraspanin 6 2 2
MIRT700821 PHLDA2 pleckstrin homology like domain family A member 2 2 2
MIRT701350 NR4A3 nuclear receptor subfamily 4 group A member 3 2 2
MIRT702348 KLHL7 kelch like family member 7 2 2
MIRT703387 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT703883 ERBB2IP erbb2 interacting protein 2 2
MIRT708237 PPP1R26 protein phosphatase 1 regulatory subunit 26 2 2
MIRT708629 NUDT18 nudix hydrolase 18 2 2
MIRT708990 CABP4 calcium binding protein 4 2 2
MIRT709804 FOXE1 forkhead box E1 2 2
MIRT710203 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT710248 VAMP1 vesicle associated membrane protein 1 2 2
MIRT710281 FGF1 fibroblast growth factor 1 2 2
MIRT712992 IRGQ immunity related GTPase Q 2 2
MIRT713887 MOB3A MOB kinase activator 3A 2 2
MIRT715600 ADAM17 ADAM metallopeptidase domain 17 2 2
MIRT715639 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT715686 FRK fyn related Src family tyrosine kinase 2 2
MIRT717053 WIZ widely interspaced zinc finger motifs 2 2
MIRT717611 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT721539 DKK3 dickkopf WNT signaling pathway inhibitor 3 2 2
MIRT722096 SUSD1 sushi domain containing 1 2 2
MIRT722435 HRNR hornerin 2 2
MIRT722855 NEGR1 neuronal growth regulator 1 2 2
MIRT724621 SNAP25 synaptosome associated protein 25 2 2
MIRT724777 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6819 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6819-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6819-3p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-6819-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-6819-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-6819-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6819-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-6819-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission