pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3180-1 |
Genomic Coordinates | chr16: 14911220 - 14911313 |
Description | Homo sapiens miR-3180-1 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
pre-miRNA | hsa-mir-3180-2 |
Genomic Coordinates | chr16: 16309879 - 16309966 |
Description | Homo sapiens miR-3180-2 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
pre-miRNA | hsa-mir-3180-3 |
Genomic Coordinates | chr16: 18402178 - 18402271 |
Description | Homo sapiens miR-3180-3 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | hsa-miR-3180-3p |
Sequence | 62| UGGGGCGGAGCUUCCGGAGGCC |83 |
Evidence | Experimental |
Experiments | Illumina |
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | FSCN1 | ||||||||||||||||||||
Synonyms | FAN1, HSN, SNL, p55 | ||||||||||||||||||||
Description | fascin actin-bundling protein 1 | ||||||||||||||||||||
Transcript | NM_003088 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on FSCN1 | |||||||||||||||||||||
3'UTR of FSCN1 (miRNA target sites are highlighted) |
>FSCN1|NM_003088|3'UTR 1 GGCCGGCCCGTCCTTCCCCGCCCCTGCCCACATGGCGGCTCCTGCCAACCCTCCCTGCTAACCCCTTCTCCGCCAGGTGG 81 GCTCCAGGGCGGGAGGCAAGCCCCCTTGCCTTTCAAACTGGAAACCCCAGAGAAAACGGTGCCCCCACCTGTCGCCCCTA 161 TGGACTCCCCACTCTCCCCTCCGCCCGGGTTCCCTACTCCCCTCGGGTCAGCGGCTGCGGCCTGGCCCTGGGAGGGATTT 241 CAGATGCCCCTGCCCTCTTGTCTGCCACGGGGCGAGTCTGGCACCTCTTTCTTCTGACCTCAGACGGCTCTGAGCCTTAT 321 TTCTCTGGAAGCGGCTAAGGGACGGTTGGGGGCTGGGAGCCCTGGGCGTGTAGTGTAACTGGAATCTTTTGCCTCTCCCA 401 GCCACCTCCTCCCAGCCCCCCAGGAGAGCTGGGCACATGTCCCAAGCCTGTCAGTGGCCCTCCCTGGTGCACTGTCCCCG 481 AAACCCCTGCTTGGGAAGGGAAGCTGTCGGGTGGGCTAGGACTGACCCTTGTGGTGTTTTTTTGGGTGGTGGCTGGAAAC 561 AGCCCCTCTCCCACGTGGCAGAGGCTCAGCCTGGCTCCCTTCCCTGGAGCGGCAGGGCGTGACGGCCACAGGGTCTGCCC 641 GCTGCACGTTCTGCCAAGGTGGTGGTGGCGGGCGGGTAGGGGTGTGGGGGCCGTCTTCCTCCTGTCTCTTTCCTTTCACC 721 CTAGCCTGACTGGAAGCAGAAAATGACCAAATCAGTATTTTTTTTAATGAAATATTATTGCTGGAGGCGTCCCAGGCAAG 801 CCTGGCTGTAGTAGCGAGTGATCTGGCGGGGGGCGTCTCAGCACCCTCCCCAGGGGGTGCATCTCAGCCCCCTCTTTCCG 881 TCCTTCCCGTCCAGCCCCAGCCCTGGGCCTGGGCTGCCGACACCTGGGCCAGAGCCCCTGCTGTGATTGGTGCTCCCTGG 961 GCCTCCCGGGTGGATGAAGCCAGGCGTCGCCCCCTCCGGGAGCCCTGGGGTGAGCCGCCGGGGCCCCCCTGCTGCCAGCC 1041 TCCCCCGTCCCCAACATGCATCTCACTCTGGGTGTCTTGGTCTTTTATTTTTTGTAAGTGTCATTTGTATAACTCTAAAC 1121 GCCCATGATAGTAGCTTCAAACTGGAAATAGCGAAATAAAATAACTCAGTCTGCAGCCCCAGAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7
PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6
PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM545212 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000382361.3 | 3UTR | CCGUCCUUCCCCGCCCCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545215 | |
---|---|
Method / RBP | PAR-CLIP / AGO4 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000382361.3 | 3UTR | GCCGGCCCGUCCUUCCCCGCCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
66 hsa-miR-3180-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT133792 | SKI | SKI proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT146658 | MINK1 | misshapen like kinase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT441337 | C19orf26 | CACN beta subunit associated regulatory protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT449088 | XPO6 | exportin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464967 | TULP1 | tubby like protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT471706 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT473252 | MIDN | midnolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT483494 | STMN3 | stathmin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT483726 | THSD4 | thrombospondin type 1 domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485684 | CCDC64 | BICD family like cargo adaptor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT486046 | WSCD1 | WSC domain containing 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT486522 | CLCN7 | chloride voltage-gated channel 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486779 | SESTD1 | SEC14 and spectrin domain containing 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT486852 | DPF1 | double PHD fingers 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487035 | C10orf55 | chromosome 10 open reading frame 55 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487082 | C3orf36 | chromosome 3 open reading frame 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487284 | AGPAT6 | glycerol-3-phosphate acyltransferase 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT487992 | RXRB | retinoid X receptor beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT488101 | POU3F1 | POU class 3 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT488547 | POU3F3 | POU class 3 homeobox 3 | ![]() |
![]() |
2 | 8 | ||||||
MIRT488582 | ST7L | suppression of tumorigenicity 7 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT488757 | FXYD1 | FXYD domain containing ion transport regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489217 | ASCL2 | achaete-scute family bHLH transcription factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489350 | SYNGR1 | synaptogyrin 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489385 | RAB11B | RAB11B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT489459 | MSC | musculin | ![]() |
![]() |
2 | 2 | ||||||
MIRT489469 | SLITRK5 | SLIT and NTRK like family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489749 | TACC3 | transforming acidic coiled-coil containing protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490244 | MFI2 | melanotransferrin | ![]() |
![]() |
2 | 2 | ||||||
MIRT490423 | VPS51 | VPS51, GARP complex subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT490644 | FEM1A | fem-1 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT491977 | UNK | unkempt family zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT492469 | RASD1 | ras related dexamethasone induced 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT492837 | NRGN | neurogranin | ![]() |
![]() |
2 | 2 | ||||||
MIRT492956 | NEUROD2 | neuronal differentiation 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493002 | NANOS1 | nanos C2HC-type zinc finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493430 | KCNK3 | potassium two pore domain channel subfamily K member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493709 | H2AFX | H2A histone family member X | ![]() |
![]() |
2 | 6 | ||||||
MIRT493886 | FAM43A | family with sequence similarity 43 member A | ![]() |
![]() |
2 | 4 | ||||||
MIRT493955 | ENG | endoglin | ![]() |
![]() |
2 | 2 | ||||||
MIRT500168 | MSI1 | musashi RNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500196 | MAPK8IP3 | mitogen-activated protein kinase 8 interacting protein 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT500366 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 2 | ||||||
MIRT501159 | SLC10A7 | solute carrier family 10 member 7 | ![]() |
![]() |
2 | 6 | ||||||
MIRT501698 | PCGF3 | polycomb group ring finger 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512173 | CASP16 | caspase 16, pseudogene | ![]() |
![]() |
2 | 6 | ||||||
MIRT512237 | ATG2A | autophagy related 2A | ![]() |
![]() |
2 | 6 | ||||||
MIRT512879 | PITX3 | paired like homeodomain 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531184 | SIGLEC12 | sialic acid binding Ig like lectin 12 (gene/pseudogene) | ![]() |
![]() |
2 | 2 | ||||||
MIRT548362 | ENTPD5 | ectonucleoside triphosphate diphosphohydrolase 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT569093 | FSCN1 | fascin actin-bundling protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574133 | MARVELD1 | MARVEL domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635542 | LEPROTL1 | leptin receptor overlapping transcript like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654098 | RSBN1L | round spermatid basic protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT664919 | BHMT2 | betaine--homocysteine S-methyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669843 | OLR1 | oxidized low density lipoprotein receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670502 | LYRM4 | LYR motif containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670526 | SLC9A7 | solute carrier family 9 member A7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670550 | SHISA2 | shisa family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671031 | PCDHB2 | protocadherin beta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695219 | SCAMP3 | secretory carrier membrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700129 | RNF144B | ring finger protein 144B | ![]() |
![]() |
2 | 2 | ||||||
MIRT709280 | MAPK8IP2 | mitogen-activated protein kinase 8 interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712750 | GMDS | GDP-mannose 4,6-dehydratase | ![]() |
![]() |
2 | 2 | ||||||
MIRT720753 | FAM193A | family with sequence similarity 193 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT724920 | VPS18 | VPS18, CORVET/HOPS core subunit | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|