pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3937 |
Genomic Coordinates | chrX: 39661216 - 39661321 |
Description | Homo sapiens miR-3937 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3937 | |||||||||||||||||||||
Sequence | 61| ACAGGCGGCUGUAGCAAUGGGGG |83 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | IGDCC3 | ||||||||||||||||||||
Synonyms | HsT18880, PUNC | ||||||||||||||||||||
Description | immunoglobulin superfamily DCC subclass member 3 | ||||||||||||||||||||
Transcript | NM_004884 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on IGDCC3 | |||||||||||||||||||||
3'UTR of IGDCC3 (miRNA target sites are highlighted) |
>IGDCC3|NM_004884|3'UTR 1 CCAGTGTCTGGCAGGCTCCAGAGGGTGGACGGAGCGGGGCCCATTCTCAGGTCAAAAGCAAGATTTCTACTGTCATGTGG 81 GATTTGGATGGTCCTGGGGGCTCCCCAGCATTTCTATCCTGACTGCCTCTTGGGTTGTCAAAACCCAAGGCAGCCTTGAC 161 AGGGACCCCCCGGCCCTAACACCCATCAGGAGTTGGAGCAGTTCCTGCAGGAGCCTGTTCCTTCCCTGGGCTGACGCCCC 241 CTTGCCTCTGCCTGGTACCCACATGACTTGGAACTGAACTAACATTTTTCTTTAAAAAGCAAAACTTAAAAAAAAAAAAA 321 AAGAGGAGAGAGATAGAGGAAGGTGAATTAGACTCCAAAAGATGACCCTGCTGTAGCTGGGCCCTGACACTGTCACCCTC 401 CACCGACTTTGTTTTCTCAGGATGGATTTTTGCTGTTTTGGCTCTCAGCACCTACCTCAGCCGGAATGAATGTCCTGGGG 481 GGCAGTGGGGCGGTGGCCTCAGCCCCCTTACCCCACAGAGCCCGAATGCACTCCTACCTCAAGTCCCCTTGCTGGGGACC 561 CCCTCTCCCTTCCCACACTGTTGTCCAGAGTAAAAAAAAAAAAAAAAAAAAAAGCACTTCCCCGTTTCCAGGTGTGAAAG 641 AAAAAAAAAAGCACTTCCCCATTTCCAGATGTGAAAGAAAATGTCTACCTCAAGGCTCGCTGGCTCTGTGGGCTGTGTTG 721 TCACTGGACCTGCCTCCCCGCCCCTCCTGCCCACAGCCCACCTACCTCTCCTGCAGAGGAGAGGCCAGAGGTTGGGCCAC 801 CAAGGGGAACTCTTGTGGCCTACAGAAATAGAAATGGATTGGGCAGAGAAAAAATGTGAAAGCAGCCAAAAATGAGAGGA 881 AATTTGTTCCTTGAAGTATAAATTGTCCAAACGAGCCACCTCCCAGCACACCGCCTGTCCCCGTCTTGTCTGTCCACTCC 961 CATTTTGAGCCAGCCCATCCTTGATGGGGATGCCCATGAGGAACCTGGGCTTGGGAGGGTGGCATCAGCTGGCCGCCTGC 1041 CTCCTGTCCTGCAGGCCCGGCCCCTGGAATGTACCATGTGTGGGATGGGTGTGTGGGAGGGTGAGGGGGTGTGGGTGTCC 1121 CCTGCAGAGGCGCCCCAGCCTCAGGCACCCAGCCAGCCTGATCCACCCCTCGACAGGGGAGCATCCACTGTCAGCAGCCA 1201 TGGCCGGAAGCTATTTTTATACAAGGTGTGTTAAGGGTTATGTTCTTGTGACTTTTTGTTACTCTTTTCTGTTGTGTTGT 1281 TCTTTGAACTACTTAGTTAAAGAAGAAGAAAAGAAAACCAAGGAAACAAATACCTATTTTTGGTTATACTCAGAAACATT 1361 TTTTTAAATAGCAGAAGAAAAACTTTTTTTAAAGAAAAAAGATAAGTGTATTCCTTAAGAATGAGACCATAAATATCCCT 1441 GACCCCCAATCCTCTAGGGACACCTCCACCCTGAACTTTAGTTAATTAGCTGAAGAAGATAGAATTTGTGGTGTTTTCCT 1521 AGAAAACTAGAGCTGTGTCCGCGTGGACTTGGGGAAGGGTAGTCCCTTCCCTTCTCCCAAATGATGTGTGGATGCCCAGG 1601 GCTCCACAAAGCTCCAAGGCAGTGCCCCCTCTGTTCCCAAAGCAGCTTCTCTCGGGAGCCTCCCTCTCCCTTGGGAAGGG 1681 TGCGGCTGGGGCAGGAGGGGGCTGGGGGGCCACCTGGCCTTACTTGGGTTTTGTCACACTCTGCTCATTTTGACTGAATA 1761 AAAGTCCTGTTGCCAAAGTGAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8
PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1
PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8
PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1
PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
PAR-CLIP data was present in ERX177607. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_9
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM545213 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000327987.4 | 3UTR | CACACCGCCUGUCCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000327987.4 | 3UTR | CACACCGCCUGUCCCCGUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM545215 | |
---|---|
Method / RBP | PAR-CLIP / AGO4 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000327987.4 | 3UTR | ACACCGCCUGUCCCCGUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
40 hsa-miR-3937 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT332487 | CD81 | CD81 molecule | 2 | 2 | ||||||||
MIRT441327 | NDUFA11 | NADH:ubiquinone oxidoreductase subunit A11 | 2 | 4 | ||||||||
MIRT454032 | EIF3CL | eukaryotic translation initiation factor 3 subunit C like | 2 | 2 | ||||||||
MIRT458086 | EIF3C | eukaryotic translation initiation factor 3 subunit C | 2 | 2 | ||||||||
MIRT460785 | VPS37B | VPS37B, ESCRT-I subunit | 2 | 2 | ||||||||
MIRT463150 | ZNF385A | zinc finger protein 385A | 2 | 4 | ||||||||
MIRT467162 | SREBF2 | sterol regulatory element binding transcription factor 2 | 2 | 2 | ||||||||
MIRT469618 | RAI1 | retinoic acid induced 1 | 2 | 4 | ||||||||
MIRT472258 | NFIC | nuclear factor I C | 2 | 2 | ||||||||
MIRT487587 | FAM83H | family with sequence similarity 83 member H | 2 | 4 | ||||||||
MIRT489302 | B4GALNT4 | beta-1,4-N-acetyl-galactosaminyltransferase 4 | 2 | 4 | ||||||||
MIRT489741 | GNAI2 | G protein subunit alpha i2 | 2 | 4 | ||||||||
MIRT490038 | PCSK4 | proprotein convertase subtilisin/kexin type 4 | 2 | 2 | ||||||||
MIRT490767 | SRCIN1 | SRC kinase signaling inhibitor 1 | 2 | 2 | ||||||||
MIRT491750 | SEMA3F | semaphorin 3F | 2 | 2 | ||||||||
MIRT492690 | PHYHIP | phytanoyl-CoA 2-hydroxylase interacting protein | 2 | 2 | ||||||||
MIRT504843 | RRP36 | ribosomal RNA processing 36 | 2 | 4 | ||||||||
MIRT510116 | IRAK3 | interleukin 1 receptor associated kinase 3 | 2 | 8 | ||||||||
MIRT525313 | FANCA | Fanconi anemia complementation group A | 2 | 4 | ||||||||
MIRT569801 | IGDCC3 | immunoglobulin superfamily DCC subclass member 3 | 2 | 2 | ||||||||
MIRT570224 | SLC27A1 | solute carrier family 27 member 1 | 2 | 2 | ||||||||
MIRT629378 | FAHD1 | fumarylacetoacetate hydrolase domain containing 1 | 2 | 2 | ||||||||
MIRT633104 | CBX5 | chromobox 5 | 2 | 2 | ||||||||
MIRT645036 | ATAD3C | ATPase family, AAA domain containing 3C | 2 | 2 | ||||||||
MIRT660973 | ABI2 | abl interactor 2 | 2 | 2 | ||||||||
MIRT671225 | CLSTN1 | calsyntenin 1 | 2 | 2 | ||||||||
MIRT672046 | SMTNL2 | smoothelin like 2 | 2 | 2 | ||||||||
MIRT677314 | CPSF2 | cleavage and polyadenylation specific factor 2 | 2 | 2 | ||||||||
MIRT678290 | PTRH2 | peptidyl-tRNA hydrolase 2 | 2 | 2 | ||||||||
MIRT693477 | ZNF707 | zinc finger protein 707 | 2 | 2 | ||||||||
MIRT693576 | PIGR | polymeric immunoglobulin receptor | 2 | 2 | ||||||||
MIRT696832 | PLLP | plasmolipin | 2 | 2 | ||||||||
MIRT700149 | RNF115 | ring finger protein 115 | 2 | 2 | ||||||||
MIRT703760 | FAM118A | family with sequence similarity 118 member A | 2 | 2 | ||||||||
MIRT705798 | ALDH6A1 | aldehyde dehydrogenase 6 family member A1 | 2 | 2 | ||||||||
MIRT709105 | SEPT4 | septin 4 | 2 | 2 | ||||||||
MIRT710235 | ARMCX6 | armadillo repeat containing, X-linked 6 | 2 | 2 | ||||||||
MIRT711422 | EPHA4 | EPH receptor A4 | 2 | 2 | ||||||||
MIRT712529 | CYTH2 | cytohesin 2 | 2 | 2 | ||||||||
MIRT714081 | ZNF532 | zinc finger protein 532 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|