miRTarBase - #MIRT569827


—
pre-miRNA Information
pre-miRNA hsa-mir-151b   
Genomic Coordinates chr14: 100109419 - 100109514
Description Homo sapiens miR-151b stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-151b
Sequence 60| UCGAGGAGCUCACAGUCU |77
Evidence Experimental
Experiments RAKE
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs530616727 2 dbSNP
rs1447689330 3 dbSNP
rs1167577108 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CRMP1   
Synonyms CRMP-1, DPYSL1, DRP-1, DRP1, ULIP-3
Description collapsin response mediator protein 1
Transcript NM_001014809   
Other Transcripts NM_001313   
Expression
Putative miRNA Targets on CRMP1
3'UTR of CRMP1
(miRNA target sites are highlighted)		 
>CRMP1|NM_001014809|3'UTR
   1 ACGTGGATGCGCGGAGGAGCTAGCCTGAAGGATTCTGGGAATCATGTCCATCCCTTTTCCTGTCAGTGTTTTTGAAACCC
  81 ACAGTTTTAGTTGGTGCTGATGGAGGGAGGGGGAAGTCGAAGGATGCTCTTTCCCTTTTCTGTTTAGGAAGAAGTGGTAC
 161 TAGTGTGGTGTGTTTGCTTGGAAATTCCTTGCCCCACAGTTGTGTTCATGCTGAATCCACCTCGGAGCATGGTGTTTTCA
 241 TTCCCCCTTCCTAGTGAACCACAGGTTTTAGCATTGTCTTGTTCTGTCCCTTCCACTTCTAACTCCACTGGCTCCATGAT
 321 TCTCTGAGTGGTGGTTCCTTTGCACCCTGTAGATGTTCTAGGATAGTTGATGCATGTTACTAAATTACGTATGCAAGTCT
 401 GTGAGTGCGTCTGAGGGGACATCGCCAAGGACTGACTGAGACACGATGCCGAGACCTCAAGCCCTGAGGGGCAGTCCCAA
 481 AACCCTTACAGTGAAGATGTTTACTCATTGCCCCCACCTCTGGTCCACACTAGAAAGAAGCTCGCCCCACCTCCACCTGT
 561 GAGATCCGTGAATTCTCGGAATGGCAGGGGAAGCCTTGCACTAGGTTGCAGAGAAGCATCCTCCACATCCTGTGTCAGAA
 641 ACCCTGGTCTCCGTGGCACTTGTAACTCACCGTGCTGTCTTCTGGTCTGTGTGTGTTCTTCAAGCCAGCTCTAGGCTTCA
 721 GGCCGAGCCAGGTTCACACTCAGAAAGAGGTCTCCCCATCCCCATTCGGGGCTGACGATGGGGGGCTGATGGCTGCCCCT
 801 GCGTGGCCTGAGTCCTGGTCCCTCTGAGGCAGTTGACGGGGCAGTCAGATTTTTAAAGTTTTGTACAAAGTTTTCCTTTG
 881 TAATCACTCCCATTTTTACTTAACAACCAACTTGTTGTGGCTCTTATTTCTGAATTCAAAGCTTGTGAAAAAATAAAGAA
 961 AATGAACTGCCCACTGACCTGACTAGGGCACTTTCAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucuGACACUCGAGGAGCu 5'
             :||  | :||||:| 
Target 5' tgcTTGGAAATTCCTTGc 3'
 175 - 192 115.00 -8.80
2 
miRNA  3' ucUGACACUCGAGGAGCu 5'
            :|||    | ||||| 
Target 5' atGCTGAATCCACCTCGg 3'
 208 - 225 112.00 -11.30
3 
miRNA  3' ucugACACUCGAGGAGcu 5'
              |||| |:||:||  
Target 5' tctgTGTGTGTTCTTCaa 3'
 686 - 703 110.00 -13.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN22070367 11 COSMIC
COSN6835889 20 COSMIC
COSN31497185 74 COSMIC
COSN30735294 177 COSMIC
COSN31522127 267 COSMIC
COSN17183098 297 COSMIC
COSN30169937 352 COSMIC
COSN29572949 408 COSMIC
COSN20099772 954 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1359769415 1 dbSNP
rs142829070 2 dbSNP
rs777513481 3 dbSNP
rs758342117 6 dbSNP
rs1270154887 7 dbSNP
rs747958342 8 dbSNP
rs1328536217 9 dbSNP
rs764540850 10 dbSNP
rs1404554064 11 dbSNP
rs754670949 12 dbSNP
rs200221510 13 dbSNP
rs765901116 15 dbSNP
rs755550555 17 dbSNP
rs750577945 21 dbSNP
rs201013391 23 dbSNP
rs1266479499 24 dbSNP
rs1198491985 25 dbSNP
rs764571830 26 dbSNP
rs763514749 27 dbSNP
rs372112723 32 dbSNP
rs762347676 32 dbSNP
rs981092624 38 dbSNP
rs1201767342 39 dbSNP
rs775760953 41 dbSNP
rs1273151577 42 dbSNP
rs765676265 45 dbSNP
rs1320691692 46 dbSNP
rs1281768072 50 dbSNP
rs765559945 54 dbSNP
rs1023302639 55 dbSNP
rs1486427848 61 dbSNP
rs1328042092 62 dbSNP
rs1226079849 65 dbSNP
rs990032018 66 dbSNP
rs150797245 70 dbSNP
rs752479927 74 dbSNP
rs1211237665 78 dbSNP
rs892339784 81 dbSNP
rs1053718151 84 dbSNP
rs570546435 84 dbSNP
rs998869768 87 dbSNP
rs901864619 88 dbSNP
rs1262857100 89 dbSNP
rs536678068 91 dbSNP
rs1007496559 93 dbSNP
rs889412850 94 dbSNP
rs1177563716 101 dbSNP
rs1049745111 102 dbSNP
rs1225908378 105 dbSNP
rs572486136 107 dbSNP
rs1351196484 108 dbSNP
rs1292697861 110 dbSNP
rs1039082080 112 dbSNP
rs1296629186 112 dbSNP
rs1371594707 114 dbSNP
rs1236458957 115 dbSNP
rs1186205941 118 dbSNP
rs375841716 119 dbSNP
rs527740334 123 dbSNP
rs141382799 128 dbSNP
rs138783492 130 dbSNP
rs939783398 132 dbSNP
rs1466438145 140 dbSNP
rs1207169961 164 dbSNP
rs1247839845 168 dbSNP
rs1343151096 169 dbSNP
rs1193484266 171 dbSNP
rs1161220564 173 dbSNP
rs1401174429 174 dbSNP
rs1432024582 177 dbSNP
rs950754759 177 dbSNP
rs919493779 178 dbSNP
rs878927822 187 dbSNP
rs928352411 189 dbSNP
rs759507330 194 dbSNP
rs973718134 196 dbSNP
rs531582104 198 dbSNP
rs1395013944 204 dbSNP
rs1438512164 208 dbSNP
rs554106668 212 dbSNP
rs915836311 215 dbSNP
rs990431980 224 dbSNP
rs1002387922 227 dbSNP
rs1331445361 229 dbSNP
rs1182875649 231 dbSNP
rs1226846345 240 dbSNP
rs1267877249 243 dbSNP
rs1469241989 245 dbSNP
rs970443371 247 dbSNP
rs562872928 254 dbSNP
rs1245430387 274 dbSNP
rs1488453877 277 dbSNP
rs1177237090 284 dbSNP
rs546177367 287 dbSNP
rs1471394995 288 dbSNP
rs1158042186 291 dbSNP
rs1418306716 299 dbSNP
rs1406815311 303 dbSNP
rs1240664263 307 dbSNP
rs1218583432 308 dbSNP
rs1330376879 311 dbSNP
rs1009614824 313 dbSNP
rs1308689663 317 dbSNP
rs1272666053 326 dbSNP
rs532780770 333 dbSNP
rs892165604 334 dbSNP
rs1287891181 337 dbSNP
rs1357338121 342 dbSNP
rs1054111043 343 dbSNP
rs41269563 367 dbSNP
rs1321612377 370 dbSNP
rs1205893639 372 dbSNP
rs1253331028 375 dbSNP
rs1214147016 381 dbSNP
rs541123538 382 dbSNP
rs899773204 388 dbSNP
rs1018982915 389 dbSNP
rs1412860076 391 dbSNP
rs1435779815 393 dbSNP
rs1491425692 403 dbSNP
rs943875310 404 dbSNP
rs1368635463 405 dbSNP
rs1427835797 406 dbSNP
rs1051888732 408 dbSNP
rs1341255245 408 dbSNP
rs572143118 413 dbSNP
rs757980420 419 dbSNP
rs762567090 420 dbSNP
rs1378980416 422 dbSNP
rs889076585 423 dbSNP
rs1277314109 424 dbSNP
rs1340684369 436 dbSNP
rs1203757650 437 dbSNP
rs772738303 438 dbSNP
rs1426314882 440 dbSNP
rs145957464 444 dbSNP
rs919285749 445 dbSNP
rs995469867 446 dbSNP
rs974052845 447 dbSNP
rs1465780956 448 dbSNP
rs963597451 449 dbSNP
rs898066947 450 dbSNP
rs776941876 451 dbSNP
rs980899236 451 dbSNP
rs1025137812 456 dbSNP
rs1036558506 457 dbSNP
rs1469879947 466 dbSNP
rs1332524949 472 dbSNP
rs1416373365 472 dbSNP
rs1358810824 476 dbSNP
rs1436204361 479 dbSNP
rs939499854 501 dbSNP
rs1266061328 502 dbSNP
rs1227013408 503 dbSNP
rs1300299843 504 dbSNP
rs906986660 506 dbSNP
rs1009358078 511 dbSNP
rs1228372509 511 dbSNP
rs1305958665 514 dbSNP
rs541878714 523 dbSNP
rs1274909881 525 dbSNP
rs1297518137 532 dbSNP
rs956555536 536 dbSNP
rs1031977065 537 dbSNP
rs576083109 543 dbSNP
rs769427651 544 dbSNP
rs1246008354 555 dbSNP
rs1194251590 557 dbSNP
rs1301167462 561 dbSNP
rs752218509 563 dbSNP
rs1170912240 566 dbSNP
rs1424670589 567 dbSNP
rs1018154425 568 dbSNP
rs1297066668 575 dbSNP
rs915537048 577 dbSNP
rs142032198 578 dbSNP
rs1355895686 584 dbSNP
rs1435005226 587 dbSNP
rs1324707202 591 dbSNP
rs879541249 594 dbSNP
rs138026707 611 dbSNP
rs1329385848 612 dbSNP
rs570630735 614 dbSNP
rs924512652 615 dbSNP
rs553660623 618 dbSNP
rs1394784972 620 dbSNP
rs1269310751 623 dbSNP
rs369521214 627 dbSNP
rs187617312 633 dbSNP
rs1268213696 643 dbSNP
rs764678544 647 dbSNP
rs11554338 649 dbSNP
rs182609970 652 dbSNP
rs1164177873 658 dbSNP
rs949580757 660 dbSNP
rs1195286256 666 dbSNP
rs1385555192 668 dbSNP
rs372733500 671 dbSNP
rs369794201 672 dbSNP
rs988728020 676 dbSNP
rs1206056635 681 dbSNP
rs531642689 682 dbSNP
rs1346902523 685 dbSNP
rs1411281660 685 dbSNP
rs956459222 689 dbSNP
rs1277862058 691 dbSNP
rs1328029133 693 dbSNP
rs1245301809 697 dbSNP
rs1266952155 697 dbSNP
rs1032508918 698 dbSNP
rs979031647 699 dbSNP
rs963713891 703 dbSNP
rs552128141 705 dbSNP
rs1008119761 709 dbSNP
rs1418690792 710 dbSNP
rs1188718516 711 dbSNP
rs1028098624 712 dbSNP
rs890938429 716 dbSNP
rs536843783 724 dbSNP
rs761163084 725 dbSNP
rs1025449070 731 dbSNP
rs552843070 734 dbSNP
rs1349532526 738 dbSNP
rs1396206328 745 dbSNP
rs897872288 747 dbSNP
rs1338418706 748 dbSNP
rs1057052 749 dbSNP
rs1243793950 749 dbSNP
rs1344199426 750 dbSNP
rs1003722219 755 dbSNP
rs942003817 763 dbSNP
rs905234812 767 dbSNP
rs906659056 768 dbSNP
rs949691451 775 dbSNP
rs1045524057 776 dbSNP
rs1013050472 777 dbSNP
rs1252691038 781 dbSNP
rs918181485 783 dbSNP
rs1391375995 785 dbSNP
rs200743944 786 dbSNP
rs560759017 786 dbSNP
rs988288350 786 dbSNP
rs935504935 793 dbSNP
rs1466238500 795 dbSNP
rs1054552880 796 dbSNP
rs1277971039 797 dbSNP
rs1367306283 802 dbSNP
rs1226019894 803 dbSNP
rs540437277 804 dbSNP
rs1295513332 807 dbSNP
rs925025208 810 dbSNP
rs1234047534 812 dbSNP
rs1258043760 817 dbSNP
rs1345698154 824 dbSNP
rs1482384474 834 dbSNP
rs1203471933 837 dbSNP
rs1260066214 838 dbSNP
rs1466651707 843 dbSNP
rs1187156288 846 dbSNP
rs1236706779 849 dbSNP
rs758467599 851 dbSNP
rs746016939 854 dbSNP
rs979188540 855 dbSNP
rs397951651 859 dbSNP
rs56772303 859 dbSNP
rs1041577946 867 dbSNP
rs963662076 873 dbSNP
rs1353160664 884 dbSNP
rs778874099 889 dbSNP
rs911697858 890 dbSNP
rs1017922777 899 dbSNP
rs1319881712 901 dbSNP
rs1368196557 902 dbSNP
rs757435793 906 dbSNP
rs1303454761 908 dbSNP
rs1310693506 920 dbSNP
rs1311509252 921 dbSNP
rs1269171778 927 dbSNP
rs1331744515 931 dbSNP
rs1398152381 932 dbSNP
rs530298759 947 dbSNP
rs953612747 951 dbSNP
rs34834990 952 dbSNP
rs1403275923 954 dbSNP
rs35061424 954 dbSNP
rs377544670 954 dbSNP
rs1264596739 956 dbSNP
rs3832266 957 dbSNP
rs920689052 957 dbSNP
rs74416323 958 dbSNP
rs1158511693 959 dbSNP
rs962897761 963 dbSNP
rs1350435397 966 dbSNP
rs561792611 967 dbSNP
rs1438466978 974 dbSNP
rs1343650358 977 dbSNP
rs1452203596 978 dbSNP
rs1289287663 980 dbSNP
rs1352541111 981 dbSNP
rs1016356102 982 dbSNP
rs541940178 985 dbSNP
rs1322877233 995 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucugacacuCGAGGAGCu 5'
                   |||||||| 
Target 5' --cucccccGCUCCUCGg 3'
 		1 - 16
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000324989.7 | 3UTR | CUCCCCCGCUCCUCGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
25 hsa-miR-151b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT249674 SLC39A9 solute carrier family 39 member 9 2 4
MIRT366296 GDI1 GDP dissociation inhibitor 1 2 4
MIRT451313 LGALS3BP galectin 3 binding protein 2 2
MIRT467467 SMYD1 SET and MYND domain containing 1 2 4
MIRT477248 ERGIC2 ERGIC and golgi 2 2 2
MIRT489948 RFX2 regulatory factor X2 2 2
MIRT490364 SLC6A1 solute carrier family 6 member 1 2 4
MIRT494531 BCL7A BCL tumor suppressor 7A 2 2
MIRT500190 BARX1 BARX homeobox 1 2 4
MIRT511912 FKBP1A FK506 binding protein 1A 2 2
MIRT524875 ARHGDIA Rho GDP dissociation inhibitor alpha 2 6
MIRT555338 PPP1R3B protein phosphatase 1 regulatory subunit 3B 2 4
MIRT557122 HOXA3 homeobox A3 2 2
MIRT559034 C20orf24 chromosome 20 open reading frame 24 2 4
MIRT559824 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT568547 AKT2 AKT serine/threonine kinase 2 2 2
MIRT568714 TMEM30B transmembrane protein 30B 2 2
MIRT569827 CRMP1 collapsin response mediator protein 1 2 2
MIRT687618 LYRM4 LYR motif containing 4 2 2
MIRT689949 MANSC1 MANSC domain containing 1 2 2
MIRT690433 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT694845 KRT80 keratin 80 2 2
MIRT697594 YME1L1 YME1 like 1 ATPase 2 2
MIRT697848 UBE2Z ubiquitin conjugating enzyme E2 Z 2 2
MIRT719553 CBLB Cbl proto-oncogene B 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-151b Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-151b Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-151b Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-151b Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-151b Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-151b Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-151b Ruxolitinib 25126798 NSC763371 approved sensitive Low Myelofibrosis tissue
hsa-mir-151b Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-151b Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-151b Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-151b Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-151b Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-151b Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-151b Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-151b Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-151b Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission