pre-miRNA Information
pre-miRNA hsa-mir-4753   
Genomic Coordinates chr1: 235190034 - 235190116
Description Homo sapiens miR-4753 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4753-5p
Sequence 10| CAAGGCCAAAGGAAGAGAACAG |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs547986869 3 dbSNP
rs1007787337 7 dbSNP
rs1224263160 12 dbSNP
rs1256249071 13 dbSNP
rs1484015538 14 dbSNP
rs535678819 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DNAAF2   
Synonyms C14orf104, CILD10, KTU, PF13
Description dynein axonemal assembly factor 2
Transcript NM_001083908   
Other Transcripts NM_018139   
Expression
Putative miRNA Targets on DNAAF2
3'UTR of DNAAF2
(miRNA target sites are highlighted)
>DNAAF2|NM_001083908|3'UTR
   1 TTCTATATAATTTTGGACTTTTAAATATTAAGGTTAAAAAATACCTGTATCTAAAATTGATTCTGTTAACTGTTGTCTTA
  81 AAACTAAAGGTATTAAAGTATAAAATTAAAATTTGCAATTTTTTTTAAAAAATTGCAATTTTGATTCTCATGGGGGAAAT
 161 TGGAGATAATTTTTTTTTTTTTGCCTCTGGAGTTTAAAGTTTCCTTATGGAGATAAGTTTTGTGATTCCTGTAATAGATG
 241 TGTATGTTTTCTATTTGAGAGTTAAAACATTTGAGAGTTAAAACATTTAGTTTTAATACAACCTATGTATATATACTTCT
 321 GTGTTAAATTTTGCTTTGTCATTAATAAAATTTAAAAATATTCACTAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gacAAGAGAAG--GAAACCGGAAc 5'
             |||| | :  :||||| ||| 
Target 5' ---TTCTATATAATTTTGGACTTt 3'
1 - 21 129.00 -9.30
2
miRNA  3' gacAAGAGAAGGAAACCGGAac 5'
             ||:|:||::||| ||||  
Target 5' taaTTTTTTTTTTTTTGCCTct 3'
167 - 188 127.00 -11.20
3
miRNA  3' gacAAGAGAA-GGAAACCGGAAc 5'
             |||| ||  || | |:||| 
Target 5' tgaTTCTGTTAACTGTTGTCTTa 3'
58 - 80 115.00 -9.13
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
313274 126 ClinVar
884150 157 ClinVar
313273 183 ClinVar
313272 191 ClinVar
884149 213 ClinVar
313271 295 ClinVar
313270 328 ClinVar
COSN30109758 65 COSMIC
COSN31522846 102 COSMIC
COSN31559074 103 COSMIC
COSN31487968 125 COSMIC
COSN15662867 126 COSMIC
COSN6252866 137 COSMIC
COSN27206710 170 COSMIC
COSN8843930 242 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs528698497 5 dbSNP
rs1341296021 7 dbSNP
rs192899037 8 dbSNP
rs566758458 17 dbSNP
rs1347867828 18 dbSNP
rs770435695 21 dbSNP
rs765290990 32 dbSNP
rs1171354461 36 dbSNP
rs772368193 41 dbSNP
rs1167832644 42 dbSNP
rs749123028 43 dbSNP
rs777482756 45 dbSNP
rs1419438362 46 dbSNP
rs1296779105 48 dbSNP
rs1190241660 49 dbSNP
rs1405838735 59 dbSNP
rs1406152136 64 dbSNP
rs546757721 79 dbSNP
rs951735674 81 dbSNP
rs187830950 84 dbSNP
rs1280312592 86 dbSNP
rs561374548 89 dbSNP
rs1044364957 99 dbSNP
rs571401882 125 dbSNP
rs8952 126 dbSNP
rs372666364 127 dbSNP
rs1361487992 131 dbSNP
rs201753356 133 dbSNP
rs79975294 133 dbSNP
rs939054850 136 dbSNP
rs927687588 137 dbSNP
rs1449319436 138 dbSNP
rs1036808221 147 dbSNP
rs1010007979 157 dbSNP
rs1346928640 161 dbSNP
rs530460999 169 dbSNP
rs1387542219 170 dbSNP
rs1393173840 183 dbSNP
rs879075266 183 dbSNP
rs879160187 183 dbSNP
rs886050525 191 dbSNP
rs1329672190 199 dbSNP
rs939666787 200 dbSNP
rs936675864 205 dbSNP
rs564891226 212 dbSNP
rs1306803095 220 dbSNP
rs1361255107 222 dbSNP
rs909585414 222 dbSNP
rs1245265744 224 dbSNP
rs925268737 231 dbSNP
rs545151034 245 dbSNP
rs1197007227 259 dbSNP
rs1422522286 268 dbSNP
rs984408431 270 dbSNP
rs953988451 273 dbSNP
rs932055061 274 dbSNP
rs921071231 276 dbSNP
rs1261946450 279 dbSNP
rs1424709036 284 dbSNP
rs1187324716 285 dbSNP
rs572958055 286 dbSNP
rs1033235488 289 dbSNP
rs1464023533 289 dbSNP
rs962199981 290 dbSNP
rs886050524 295 dbSNP
rs1261647395 296 dbSNP
rs777335572 297 dbSNP
rs965211982 319 dbSNP
rs1310943517 321 dbSNP
rs1285345675 323 dbSNP
rs541064529 327 dbSNP
rs12160 328 dbSNP
rs1278767411 330 dbSNP
rs1340134035 336 dbSNP
rs999603420 339 dbSNP
rs967105356 341 dbSNP
rs1196231113 349 dbSNP
rs1276484219 349 dbSNP
rs1483397312 352 dbSNP
rs1200219483 358 dbSNP
rs757361238 361 dbSNP
rs1254584983 366 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000298292.8 | 3UTR | GCCUUCUUAGCUCAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
94 hsa-miR-4753-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064916 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT161166 SLC25A36 solute carrier family 25 member 36 2 2
MIRT285542 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT308266 LRIG1 leucine rich repeats and immunoglobulin like domains 1 2 2
MIRT311425 LMNB1 lamin B1 2 2
MIRT373989 PEBP1 phosphatidylethanolamine binding protein 1 2 4
MIRT383141 CRY2 cryptochrome circadian clock 2 2 2
MIRT405243 ADIPOR2 adiponectin receptor 2 2 2
MIRT441620 ROCK1 Rho associated coiled-coil containing protein kinase 1 2 6
MIRT441789 SRPK1 SRSF protein kinase 1 2 2
MIRT441804 NOC3L NOC3 like DNA replication regulator 2 2
MIRT441832 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT442005 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT442411 LIMD1 LIM domains containing 1 2 2
MIRT442708 UBE4B ubiquitination factor E4B 2 2
MIRT442714 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT442738 SERINC5 serine incorporator 5 2 2
MIRT442793 CEP170 centrosomal protein 170 2 2
MIRT442984 ZNF736 zinc finger protein 736 2 2
MIRT443055 THRB thyroid hormone receptor beta 2 2
MIRT443288 ZC3H12A zinc finger CCCH-type containing 12A 2 2
MIRT443325 SLC35G1 solute carrier family 35 member G1 2 2
MIRT443331 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT443593 ZNF439 zinc finger protein 439 2 4
MIRT443696 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT443748 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT443866 HDLBP high density lipoprotein binding protein 2 2
MIRT461185 LTBP2 latent transforming growth factor beta binding protein 2 2 2
MIRT464074 WAC WW domain containing adaptor with coiled-coil 2 2
MIRT468738 SDC4 syndecan 4 2 2
MIRT470540 COASY Coenzyme A synthase 2 2
MIRT476458 GBA2 glucosylceramidase beta 2 2 2
MIRT479470 CDK6 cyclin dependent kinase 6 2 2
MIRT486351 TACC2 transforming acidic coiled-coil containing protein 2 2 8
MIRT495126 CXorf67 chromosome X open reading frame 67 2 2
MIRT495166 CNGA2 cyclic nucleotide gated channel alpha 2 2 4
MIRT495432 ATG7 autophagy related 7 2 2
MIRT495922 FBXO41 F-box protein 41 2 2
MIRT496572 DGCR6L DiGeorge syndrome critical region gene 6 like 2 2
MIRT498277 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT498431 DDX39A DExD-box helicase 39A 2 2
MIRT530149 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 2 2
MIRT530313 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT530880 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT531177 ZNF626 zinc finger protein 626 2 2
MIRT533395 TYRP1 tyrosinase related protein 1 2 2
MIRT533709 TMEM64 transmembrane protein 64 2 2
MIRT533954 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 2
MIRT535616 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT539472 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT542878 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT559077 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT559465 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT561233 ZNF772 zinc finger protein 772 2 2
MIRT563477 POLE3 DNA polymerase epsilon 3, accessory subunit 2 2
MIRT563995 SLFN11 schlafen family member 11 2 2
MIRT564222 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT566017 RHOA ras homolog family member A 2 2
MIRT566028 RFX1 regulatory factor X1 2 2
MIRT566591 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT567874 CTDSP1 CTD small phosphatase 1 2 2
MIRT568552 AKT2 AKT serine/threonine kinase 2 2 2
MIRT569357 EFHC1 EF-hand domain containing 1 2 2
MIRT569973 DNAAF2 dynein axonemal assembly factor 2 2 2
MIRT614423 ZNF440 zinc finger protein 440 2 2
MIRT628831 SLC25A34 solute carrier family 25 member 34 2 2
MIRT630142 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT634479 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT634498 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT637394 R3HDM2 R3H domain containing 2 2 2
MIRT641840 TCF7L2 transcription factor 7 like 2 2 2
MIRT644397 CDKL1 cyclin dependent kinase like 1 2 2
MIRT644888 C2orf50 chromosome 2 open reading frame 50 2 2
MIRT647124 ZNF446 zinc finger protein 446 2 2
MIRT647420 SSTR3 somatostatin receptor 3 2 2
MIRT650297 PYCARD PYD and CARD domain containing 2 2
MIRT655488 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT658185 FBXO9 F-box protein 9 2 2
MIRT660931 ADAM19 ADAM metallopeptidase domain 19 2 2
MIRT665317 ZBTB3 zinc finger and BTB domain containing 3 2 2
MIRT670350 C1orf106 chromosome 1 open reading frame 106 2 4
MIRT670823 NICN1 nicolin 1 2 2
MIRT671825 TRPM6 transient receptor potential cation channel subfamily M member 6 2 2
MIRT672732 NETO2 neuropilin and tolloid like 2 2 2
MIRT674841 GLRX2 glutaredoxin 2 2 2
MIRT675930 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT686786 AZF1 azoospermia factor 1 2 2
MIRT697723 USP8 ubiquitin specific peptidase 8 2 2
MIRT702357 KLHL26 kelch like family member 26 2 2
MIRT704361 DBR1 debranching RNA lariats 1 2 2
MIRT709242 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT714433 SNED1 sushi, nidogen and EGF like domains 1 2 2
MIRT717000 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT720875 ADCY5 adenylate cyclase 5 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4753 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4753-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4753-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4753-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4753-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4753-5p Platinum 23939 resistant tissue
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission