pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4291 |
Genomic Coordinates | chr9: 93819357 - 93819421 |
Description | Homo sapiens miR-4291 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4291 | ||||||||||||
Sequence | 11| UUCAGCAGGAACAGCU |26 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | SOLiD | ||||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | POLQ | ||||||||||||||||||||
Synonyms | PRO0327 | ||||||||||||||||||||
Description | DNA polymerase theta | ||||||||||||||||||||
Transcript | NM_199420 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on POLQ | |||||||||||||||||||||
3'UTR of POLQ (miRNA target sites are highlighted) |
>POLQ|NM_199420|3'UTR
1 CTGTGCTGTTGATGAAGTCCTCCCAGGGAAGCCTGTGCAGATGCAGTCACCTGGAAAGAACAGAGATTACCCTTTCACCT
81 ACCTCAGCAAAACAAACTTTCAAGTCTTGATAGACTTAGCCTAGTAATTTTATAGTGAGAGTTTCAAACTATATATCAGT
161 GTCTATAGCATCAAAAACTTCTGGGGGCGTGGGGGAAGTAGAATACCAAGTATAATAGTTACATTCACTTTCAAAGAGCA
241 TCTATGAATTTGCCTTTTGTAACTTACTGTGGCTTTAAACATATTCAGAACAGATGCTTGAAATATGCACTTAGCACTTT
321 GGTTCCACATCTGTCTGGGTAAACCATGAAGAAAATGAAGCTGCTGCCTCAATCGACCCAGACAGCAGCCATAGGCAGAT
401 AAAGATTTGGTTTCACCCTGGTGGTGGTAGGCATCGTGTGTGACTTTTTTTCCTCTAATATCAATTTTACAGTACGGAAA
481 TAGTATTTTAAAATAGTATTGGCTAATAAATTATGAATTCTATAAAGTAGTAAGACTTGGTATGGTTGGAGTGTAGGAAT
561 GAATATTCATGAAATGTTTCTTATTGCTTTTCCTTCCCTAATTCATACAATGAATGTATTTGGAATACTTACATATTATA
641 AAATAAACTATACCTCTTCAAGAGGTATCCTGTTCTGTAAGATCAGATGTTTTTATTGCAGGTCAATATAATACTGCCAG
721 AGACAGAAAATACCCCCTTATCAGTCCCTTAGTGCCTCTTTCTGTTTGTGGCATGGTGAGAAAACCCATGCTGAAAAGAT
801 TGTACTTTGTGATCCCAATCAGAGGGATGGAGCTAATCTTTTTGCTGTTGAAATAAAATGAATTTATGAGAAACTTTAAA
881 AAAAA
Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
CLIP-seq Support 1 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000372226.1 | 3UTR | AAUCCCACUGCUGACAGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
82 hsa-miR-4291 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT102445 | CALU | calumenin | ![]() |
![]() |
2 | 4 | ||||||
MIRT108677 | ZBTB33 | zinc finger and BTB domain containing 33 | ![]() |
![]() |
2 | 4 | ||||||
MIRT125969 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT179018 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT379033 | CDK6 | cyclin dependent kinase 6 | ![]() |
![]() |
2 | 6 | ||||||
MIRT442473 | CPEB4 | cytoplasmic polyadenylation element binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442910 | PCBD2 | pterin-4 alpha-carbinolamine dehydratase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442979 | ZNF736 | zinc finger protein 736 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445663 | TNFSF15 | TNF superfamily member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446237 | FZD6 | frizzled class receptor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448860 | FAM49B | family with sequence similarity 49 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT455559 | TRAF1 | TNF receptor associated factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459704 | ZNF641 | zinc finger protein 641 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460608 | FEM1A | fem-1 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT462251 | LAMA4 | laminin subunit alpha 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462469 | FIZ1 | FLT3 interacting zinc finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466656 | TAF1D | TATA-box binding protein associated factor, RNA polymerase I subunit D | ![]() |
![]() |
2 | 6 | ||||||
MIRT466841 | STX6 | syntaxin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471403 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471517 | PCGF3 | polycomb group ring finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471681 | PABPN1 | poly(A) binding protein nuclear 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472858 | MTHFD2 | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase | ![]() |
![]() |
2 | 2 | ||||||
MIRT474813 | KIAA0226 | RUN and cysteine rich domain containing beclin 1 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT474931 | KCTD15 | potassium channel tetramerization domain containing 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475814 | HDGF | heparin binding growth factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT480434 | C17orf49 | chromosome 17 open reading frame 49 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480903 | BCL2L2-PABPN1 | BCL2L2-PABPN1 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT481478 | ARL8B | ADP ribosylation factor like GTPase 8B | ![]() |
![]() |
2 | 2 | ||||||
MIRT484982 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT485019 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | ![]() |
![]() |
2 | 8 | ||||||
MIRT485036 | TMEM189 | transmembrane protein 189 | ![]() |
![]() |
2 | 8 | ||||||
MIRT495074 | HEYL | hes related family bHLH transcription factor with YRPW motif-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT496004 | CD180 | CD180 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT500675 | TRIM37 | tripartite motif containing 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504544 | ZNF417 | zinc finger protein 417 | ![]() |
![]() |
2 | 6 | ||||||
MIRT506782 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 6 | ||||||
MIRT507256 | FGF2 | fibroblast growth factor 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT507386 | EN2 | engrailed homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512505 | BTBD19 | BTB domain containing 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516903 | CTSB | cathepsin B | ![]() |
![]() |
2 | 2 | ||||||
MIRT528124 | PPP1R10 | protein phosphatase 1 regulatory subunit 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528874 | ATF3 | activating transcription factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536091 | MBOAT2 | membrane bound O-acyltransferase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541079 | RLIM | ring finger protein, LIM domain interacting | ![]() |
![]() |
2 | 2 | ||||||
MIRT541099 | RAF1 | Raf-1 proto-oncogene, serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT545360 | LIN7C | lin-7 homolog C, crumbs cell polarity complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT545831 | ZNF367 | zinc finger protein 367 | ![]() |
![]() |
2 | 4 | ||||||
MIRT547115 | PHLPP2 | PH domain and leucine rich repeat protein phosphatase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547312 | NPTN | neuroplastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT547959 | HIGD1A | HIG1 hypoxia inducible domain family member 1A | ![]() |
![]() |
2 | 4 | ||||||
MIRT549943 | RPL7L1 | ribosomal protein L7 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT550749 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565145 | TUBB2A | tubulin beta 2A class IIa | ![]() |
![]() |
2 | 2 | ||||||
MIRT571050 | POLQ | DNA polymerase theta | ![]() |
![]() |
2 | 2 | ||||||
MIRT571361 | ZNF45 | zinc finger protein 45 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610133 | FOXI2 | forkhead box I2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613145 | DSE | dermatan sulfate epimerase | ![]() |
![]() |
2 | 2 | ||||||
MIRT613379 | ABCC12 | ATP binding cassette subfamily C member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615752 | C6 | complement C6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT616460 | ADRA2B | adrenoceptor alpha 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT616719 | FEM1B | fem-1 homolog B | ![]() |
![]() |
2 | 2 | ||||||
MIRT618312 | IPP | intracisternal A particle-promoted polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT631491 | RASSF4 | Ras association domain family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643134 | PLCXD2 | phosphatidylinositol specific phospholipase C X domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643482 | DISC1 | disrupted in schizophrenia 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649715 | TWSG1 | twisted gastrulation BMP signaling modulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653542 | SLC38A7 | solute carrier family 38 member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666307 | SLC22A3 | solute carrier family 22 member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692005 | NAP1L4 | nucleosome assembly protein 1 like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696838 | ARL2BP | ADP ribosylation factor like GTPase 2 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT698204 | TMEM248 | transmembrane protein 248 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703316 | GDPD5 | glycerophosphodiester phosphodiesterase domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709376 | FAM13A | family with sequence similarity 13 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT710112 | MED23 | mediator complex subunit 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711975 | HOMER2 | homer scaffolding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712275 | PPIP5K2 | diphosphoinositol pentakisphosphate kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714108 | TMED9 | transmembrane p24 trafficking protein 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719113 | MAML1 | mastermind like transcriptional coactivator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719727 | SLC39A11 | solute carrier family 39 member 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720018 | TFAP2C | transcription factor AP-2 gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT720358 | ZBTB8B | zinc finger and BTB domain containing 8B | ![]() |
![]() |
2 | 2 | ||||||
MIRT720372 | NUDT3 | nudix hydrolase 3 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|