miRTarBase - #MIRT571167


—
pre-miRNA Information
pre-miRNA hsa-mir-4749   
Genomic Coordinates chr19: 49854591 - 49854651
Description Homo sapiens miR-4749 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4749-3p
Sequence 42| CGCCCCUCCUGCCCCCACAG |61
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN19730808 2 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs147943327 1 dbSNP
rs148982635 2 dbSNP
rs372882504 3 dbSNP
rs200056596 4 dbSNP
rs570340094 5 dbSNP
rs778438436 11 dbSNP
rs748573000 13 dbSNP
rs770230641 14 dbSNP
rs201103722 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF85   
Synonyms HPF4, HTF1
Description zinc finger protein 85
Transcript NM_003429   
Expression
Putative miRNA Targets on ZNF85
3'UTR of ZNF85
(miRNA target sites are highlighted)		 
>ZNF85|NM_003429|3'UTR
   1 AAATTATGGCAAAGCTTTAATCAATTTACAAGTCTTACTAAACATAAGAAAATTTATACTGGAGAGAAACTACTAACCTG
  81 AAAGATGTGACAATAATTTTGACAACACCTCAGACTTATAAAAGTAATCATACTGGTGAGAAATTCTAAAAATGTGAAGA
 161 CTATGGCAAAGTCTTTAAATGGTTGTCACACTTTAGGTAAGATAATTCATATTGGAACAAACTACAAGTGCAAACAATGT
 241 GGCAAAACTTAATTTATGCTCACACCTTACTGCACAGAAAAGAATTTTTAGTTGAGAAAAAGTATACAAATATAAAGAAT
 321 GTGGAAAAGCCGTTAATATCTGCTCACATCTTACTCAGCATCAGAAAGTACTTAATAAAAGCATTATAAATGGAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN13791967 27 COSMIC
COSN30145302 76 COSMIC
COSN20115603 119 COSMIC
COSN30565017 121 COSMIC
COSN30177333 152 COSMIC
COSN20115605 178 COSMIC
COSN20115607 196 COSMIC
COSN6139678 227 COSMIC
COSN23268226 324 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1325350502 4 dbSNP
rs370544885 7 dbSNP
rs1464204273 10 dbSNP
rs373664434 12 dbSNP
rs764516013 16 dbSNP
rs547433359 17 dbSNP
rs56137123 22 dbSNP
rs1019401984 25 dbSNP
rs767919394 32 dbSNP
rs201368631 33 dbSNP
rs1259750347 40 dbSNP
rs1478811352 44 dbSNP
rs751001161 47 dbSNP
rs1347304851 49 dbSNP
rs752274992 49 dbSNP
rs983178061 52 dbSNP
rs907583482 54 dbSNP
rs1475088256 56 dbSNP
rs1191602350 61 dbSNP
rs944872860 67 dbSNP
rs1195476866 73 dbSNP
rs988658469 76 dbSNP
rs1209108748 81 dbSNP
rs1255770906 81 dbSNP
rs1040587832 84 dbSNP
rs536152830 87 dbSNP
rs1020142455 89 dbSNP
rs555745788 92 dbSNP
rs970715078 102 dbSNP
rs1338082222 103 dbSNP
rs1466552530 106 dbSNP
rs569525227 110 dbSNP
rs979451254 117 dbSNP
rs59182323 118 dbSNP
rs538097096 119 dbSNP
rs1292323317 120 dbSNP
rs1412642006 125 dbSNP
rs932252365 130 dbSNP
rs938070662 131 dbSNP
rs557910794 132 dbSNP
rs56339351 136 dbSNP
rs1409276029 140 dbSNP
rs903871774 155 dbSNP
rs55637671 162 dbSNP
rs1037310217 163 dbSNP
rs554157883 164 dbSNP
rs1031097584 167 dbSNP
rs1476346735 168 dbSNP
rs897397834 174 dbSNP
rs1181604275 176 dbSNP
rs35802891 176 dbSNP
rs74192363 176 dbSNP
rs763521613 176 dbSNP
rs896528013 177 dbSNP
rs1196982246 184 dbSNP
rs1272077211 192 dbSNP
rs201500931 192 dbSNP
rs369117648 192 dbSNP
rs1231073842 194 dbSNP
rs1306175243 195 dbSNP
rs1357042067 197 dbSNP
rs28441279 198 dbSNP
rs73021542 202 dbSNP
rs1333855887 203 dbSNP
rs970281751 210 dbSNP
rs759962202 213 dbSNP
rs1027500846 217 dbSNP
rs1341596610 221 dbSNP
rs951723201 221 dbSNP
rs983040073 223 dbSNP
rs907530944 224 dbSNP
rs1199448701 232 dbSNP
rs73021543 233 dbSNP
rs968663529 248 dbSNP
rs1211588342 249 dbSNP
rs1235049911 249 dbSNP
rs114061406 257 dbSNP
rs1251825184 258 dbSNP
rs1211319979 264 dbSNP
rs1336438268 265 dbSNP
rs73021544 271 dbSNP
rs959735318 272 dbSNP
rs577468539 276 dbSNP
rs1348279072 279 dbSNP
rs1281138237 280 dbSNP
rs186952347 283 dbSNP
rs917987626 286 dbSNP
rs1044012417 289 dbSNP
rs970912857 291 dbSNP
rs904069350 294 dbSNP
rs1443237897 303 dbSNP
rs1395432512 307 dbSNP
rs764955272 308 dbSNP
rs1399256790 313 dbSNP
rs1052484064 316 dbSNP
rs1410621894 320 dbSNP
rs73021545 332 dbSNP
rs369562752 333 dbSNP
rs1393837339 336 dbSNP
rs1393271473 341 dbSNP
rs1013700037 343 dbSNP
rs1045536354 348 dbSNP
rs1246857274 357 dbSNP
rs905722145 368 dbSNP
rs942460544 369 dbSNP
rs1240649951 372 dbSNP
rs1040803468 374 dbSNP
rs1301187664 376 dbSNP
rs1001291208 377 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacacccccguccUCCCCGc 5'
                       |||||| 
Target 5' -------------AGGGGCu 3'
 		1 - 7
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000328178.8 | 3UTR | AGGGGCUCCUCACUUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
63 hsa-miR-4749-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT082256 MED29 mediator complex subunit 29 2 4
MIRT112161 OTUD3 OTU deubiquitinase 3 2 2
MIRT150036 MIDN midnolin 2 2
MIRT246308 HIST2H2AA3 histone cluster 2 H2A family member a3 2 4
MIRT246320 HIST2H2AA4 histone cluster 2 H2A family member a4 2 4
MIRT248254 SP1 Sp1 transcription factor 2 2
MIRT257944 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT466973 STARD7 StAR related lipid transfer domain containing 7 2 4
MIRT492322 SETD1B SET domain containing 1B 2 2
MIRT496204 EFCAB1 EF-hand calcium binding domain 1 2 2
MIRT497568 CCR6 C-C motif chemokine receptor 6 2 2
MIRT502990 CCDC71L coiled-coil domain containing 71 like 2 8
MIRT508300 SIX5 SIX homeobox 5 2 4
MIRT522472 ZAK mitogen-activated protein kinase kinase kinase 20 2 2
MIRT525825 VIMP selenoprotein S 2 4
MIRT528154 BCL2L1 BCL2 like 1 2 2
MIRT532606 SPTLC2 serine palmitoyltransferase long chain base subunit 2 2 2
MIRT551302 RPRM reprimo, TP53 dependent G2 arrest mediator homolog 2 2
MIRT568777 FAM53C family with sequence similarity 53 member C 2 6
MIRT570896 METTL21A methyltransferase like 21A 2 2
MIRT570963 TMBIM4 transmembrane BAX inhibitor motif containing 4 2 2
MIRT571167 ZNF85 zinc finger protein 85 2 2
MIRT576751 Tmem127 transmembrane protein 127 2 2
MIRT609854 DAZAP2 DAZ associated protein 2 2 2
MIRT627101 PDRG1 p53 and DNA damage regulated 1 2 2
MIRT637060 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 2 2
MIRT639423 PKP1 plakophilin 1 2 2
MIRT643208 TYW3 tRNA-yW synthesizing protein 3 homolog 2 4
MIRT646251 PRSS38 protease, serine 38 2 2
MIRT647145 CYP27C1 cytochrome P450 family 27 subfamily C member 1 2 2
MIRT647429 ZKSCAN2 zinc finger with KRAB and SCAN domains 2 2 2
MIRT650666 GAPDHP44 glyceraldehyde 3 phosphate dehydrogenase pseudogene 44 2 2
MIRT651816 USP49 ubiquitin specific peptidase 49 2 2
MIRT657376 HMGA1 high mobility group AT-hook 1 2 2
MIRT658105 FOXK1 forkhead box K1 2 2
MIRT658161 FCHSD1 FCH and double SH3 domains 1 2 2
MIRT662754 LRRC3C leucine rich repeat containing 3C 2 2
MIRT667209 NIPAL1 NIPA like domain containing 1 2 2
MIRT687003 RPL35 ribosomal protein L35 2 2
MIRT707057 NACC2 NACC family member 2 2 2
MIRT709048 MRO maestro 2 2
MIRT709054 MGAT5B mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B 2 2
MIRT709446 VWA2 von Willebrand factor A domain containing 2 2 2
MIRT709847 SNX12 sorting nexin 12 2 2
MIRT710790 IFNLR1 interferon lambda receptor 1 2 2
MIRT711696 GMPR guanosine monophosphate reductase 2 2
MIRT712462 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT713884 MOB3A MOB kinase activator 3A 2 2
MIRT715329 NTN1 netrin 1 2 2
MIRT715927 CHD4 chromodomain helicase DNA binding protein 4 2 2
MIRT716533 ATF5 activating transcription factor 5 2 2
MIRT716937 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT717007 MFSD6 major facilitator superfamily domain containing 6 2 2
MIRT719139 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT720853 MEF2D myocyte enhancer factor 2D 2 2
MIRT721484 LTB4R2 leukotriene B4 receptor 2 2 2
MIRT721517 DKK3 dickkopf WNT signaling pathway inhibitor 3 2 2
MIRT722895 LRRC20 leucine rich repeat containing 20 2 2
MIRT723066 GGA1 golgi associated, gamma adaptin ear containing, ARF binding protein 1 2 2
MIRT723086 INSIG1 insulin induced gene 1 2 2
MIRT723353 ASCL2 achaete-scute family bHLH transcription factor 2 2 2
MIRT723483 MINOS1 mitochondrial inner membrane organizing system 1 2 2
MIRT724576 NOTCH2 notch 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4749 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4749 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4749 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-miR-4749-3p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-4749-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-4749-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4749-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4749-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)
hsa-miR-4749-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission