miRTarBase - #MIRT572314


—
pre-miRNA Information
pre-miRNA hsa-mir-1231   
Genomic Coordinates chr1: 201808611 - 201808702
Synonyms MIRN1231, hsa-mir-1231, MIR1231
Description Homo sapiens miR-1231 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1231
Sequence 5| GUGUCUGGGCGGACAGCUGC |24
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN25212119 11 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs768024461 3 dbSNP
rs116338160 9 dbSNP
rs112032363 10 dbSNP
rs544709517 11 dbSNP
Putative Targets

Gene Information
Gene Symbol HSPB6   
Synonyms HEL55, Hsp20, PPP1R91
Description heat shock protein family B (small) member 6
Transcript NM_144617   
Expression
Putative miRNA Targets on HSPB6
3'UTR of HSPB6
(miRNA target sites are highlighted)		 
>HSPB6|NM_144617|3'UTR
   1 GAGGGGGCTGGGCCGCGCCCGCACCCCGGGAGCCTCCTCAGGCTCCCTCTATTAAAGCCGATCTGACTCCGCCCAGCCAG
  81 ATGTCCCGAGTGCGCCAAGGACTGTCCTCTCACCCACTCCTGGATTCTGCCCTGACCTCCATCCTGGACACTGCCTTGAT
 161 AACATAGACCCTTCCACTGACACCCTCGCTCTCACACCCCCTCCAGCTTTCCGACCCCACACCGACAACTCCCCGGCTTC
 241 CAGACCCTACCAGCACTACCCTAACCCTCAGCCGACAGTCTCAGCCCCACCGACCCACTTTCTTGGCATATAGCCCCACT
 321 TAAGACCCCTCCTCTACTTCCTTCTGAGTCCTCTACAAAGACATCCGGGTACTACATTTCCATCCCTTCCCTATTTTGAC
 401 ACCAAATTATGGTGTAGACAGCCCTCCCCCAACCCCAGGCCAGTCAGGCACAATCCCCCCACCCCCCAAACGTCCTGGAC
 481 TGCACAGACCTCCCACTCCAGACCATCCAGGCCTGGTTCCCAAGACCCGATCCTTCCCCTGCAACCAGACAGTCTACAAC
 561 TGCCCCCTCCAGCCCATTTTCTGCCGTGAAACCCCAGCCAGCCACACCAGACTCTGGAACCCTTTTTCGACTGCCCCAAC
 641 TCTTGGACACCAGGCCAACTAGAACACCCAACACCAAACTGTACAGACTCTCCCACCCCAACCTCCCCAGACTCTGCACG
 721 GATGTCCTAGGCCCCCTCCCCAACTCTAACCAGACCCCATCCCCCTAAGTCCCTTTGTCTTGACCCCCAAGTCTTCAACC
 801 AGATATCCTCGGCAACCCACCTCCCACCCTCCTCCTCTTCTCCTTCAAGACCCAACTGAGCACCCGCTCTGATTCCCCAC
 881 AGCCTTTCTCCCTGCCACCACTCCCTTAGTCTTTCCCAGGCTTACTCTCCCAATAAATGTGCTAGAGCTCTGCCAAAAAA
 961 AAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgucgacaGGCG--GGUCUGUg 5'
                  |:||  ||||||| 
Target 5' tccttcccCTGCAACCAGACAg 3'
 531 - 552 146.00 -13.30
2 
miRNA  3' cgUCGAC--AGGCGGGUCUGUg 5'
            | |||  ||||||||| || 
Target 5' cgATCTGACTCCGCCCAGCCAg 3'
 59 - 80 140.00 -21.30
3 
miRNA  3' cgUCGACAGGCGGGUCUGUg 5'
            || | |:|  |||||:| 
Target 5' caAG-TCTTCAACCAGATAt 3'
 788 - 806 133.00 -12.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN24306565 16 COSMIC
COSN30612414 44 COSMIC
COSN31522510 54 COSMIC
COSN16128197 158 COSMIC
COSN29624765 165 COSMIC
COSN26636570 189 COSMIC
COSN31544602 191 COSMIC
COSN21833889 241 COSMIC
COSN31611442 273 COSMIC
COSN31536850 287 COSMIC
COSN31590715 348 COSMIC
COSN20079581 443 COSMIC
COSN25752322 497 COSMIC
COSN25127866 692 COSMIC
COSN31537996 943 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1343075193 2 dbSNP
rs11549030 5 dbSNP
rs1442460841 6 dbSNP
rs1355859344 8 dbSNP
rs1326606674 17 dbSNP
rs1409111027 19 dbSNP
rs1406761837 20 dbSNP
rs573650486 21 dbSNP
rs1468333924 24 dbSNP
rs948120700 25 dbSNP
rs1178055832 27 dbSNP
rs1314701656 28 dbSNP
rs1471288925 35 dbSNP
rs1231328031 36 dbSNP
rs915786699 39 dbSNP
rs747183197 41 dbSNP
rs1462011195 42 dbSNP
rs1265599157 43 dbSNP
rs1202300059 45 dbSNP
rs1320868570 49 dbSNP
rs935930556 50 dbSNP
rs143062937 58 dbSNP
rs1223786218 59 dbSNP
rs1375111022 60 dbSNP
rs1234885034 68 dbSNP
rs1277358670 69 dbSNP
rs758747030 71 dbSNP
rs749062434 72 dbSNP
rs977131048 74 dbSNP
rs1338693245 75 dbSNP
rs932312452 81 dbSNP
rs1180472690 84 dbSNP
rs1468157569 86 dbSNP
rs1405192310 88 dbSNP
rs780027094 90 dbSNP
rs1402483512 91 dbSNP
rs756031781 93 dbSNP
rs1158193340 95 dbSNP
rs1445663811 101 dbSNP
rs955183707 103 dbSNP
rs750343113 106 dbSNP
rs922277516 107 dbSNP
rs989883233 120 dbSNP
rs1258798958 128 dbSNP
rs1182065864 132 dbSNP
rs1461266103 135 dbSNP
rs1190632844 138 dbSNP
rs571618832 143 dbSNP
rs963785723 145 dbSNP
rs1318174381 146 dbSNP
rs775724242 147 dbSNP
rs1238968121 148 dbSNP
rs751128090 153 dbSNP
rs1316913078 155 dbSNP
rs1450107875 156 dbSNP
rs763713538 162 dbSNP
rs748825335 165 dbSNP
rs1289327684 169 dbSNP
rs779789974 171 dbSNP
rs981256447 172 dbSNP
rs1343481402 177 dbSNP
rs762629966 179 dbSNP
rs1396350390 185 dbSNP
rs1441567864 188 dbSNP
rs149052927 191 dbSNP
rs1022857093 195 dbSNP
rs1297786533 197 dbSNP
rs370292442 200 dbSNP
rs951611601 201 dbSNP
rs1026288991 205 dbSNP
rs1444336624 211 dbSNP
rs1420909190 212 dbSNP
rs991915216 213 dbSNP
rs1486599201 214 dbSNP
rs1239847675 216 dbSNP
rs952038875 218 dbSNP
rs1003786289 223 dbSNP
rs554528232 234 dbSNP
rs1408735408 235 dbSNP
rs906552073 243 dbSNP
rs190135278 251 dbSNP
rs1472072834 252 dbSNP
rs897910588 259 dbSNP
rs1012322839 273 dbSNP
rs1462932234 274 dbSNP
rs1245823979 280 dbSNP
rs893859924 286 dbSNP
rs1054221925 287 dbSNP
rs1432769553 325 dbSNP
rs935814933 327 dbSNP
rs1008991593 332 dbSNP
rs1399643567 334 dbSNP
rs1276461973 335 dbSNP
rs1447103757 335 dbSNP
rs1239860435 336 dbSNP
rs1285704223 341 dbSNP
rs1289584139 344 dbSNP
rs1320477122 350 dbSNP
rs1218502786 361 dbSNP
rs1226090770 362 dbSNP
rs903111498 365 dbSNP
rs1358708183 367 dbSNP
rs1242211734 376 dbSNP
rs1487639508 380 dbSNP
rs1190873080 383 dbSNP
rs889385354 387 dbSNP
rs1315625984 395 dbSNP
rs1475319352 415 dbSNP
rs1164002840 419 dbSNP
rs137940999 421 dbSNP
rs1050660947 422 dbSNP
rs1247978445 425 dbSNP
rs1362678378 427 dbSNP
rs985127967 431 dbSNP
rs953280226 437 dbSNP
rs1430216320 439 dbSNP
rs1419244478 451 dbSNP
rs1296403367 454 dbSNP
rs932318411 458 dbSNP
rs1415585811 459 dbSNP
rs1283999880 460 dbSNP
rs1320412836 460 dbSNP
rs1029112773 461 dbSNP
rs1422808787 462 dbSNP
rs571906073 464 dbSNP
rs1054529461 466 dbSNP
rs1353601299 473 dbSNP
rs1213889589 475 dbSNP
rs1281805647 478 dbSNP
rs1485811721 485 dbSNP
rs540472813 487 dbSNP
rs1388660287 494 dbSNP
rs550100049 496 dbSNP
rs1471001148 498 dbSNP
rs1177562330 510 dbSNP
rs1379673973 520 dbSNP
rs1486015827 529 dbSNP
rs924341726 537 dbSNP
rs1377307674 544 dbSNP
rs1435589327 545 dbSNP
rs1333683192 546 dbSNP
rs1357645395 550 dbSNP
rs1444889305 552 dbSNP
rs1243470592 553 dbSNP
rs1280482615 560 dbSNP
rs1218811184 561 dbSNP
rs1376867339 564 dbSNP
rs1490041193 566 dbSNP
rs997129988 568 dbSNP
rs1292411027 574 dbSNP
rs762851078 585 dbSNP
rs933903307 586 dbSNP
rs867395643 591 dbSNP
rs1205014223 593 dbSNP
rs796908971 597 dbSNP
rs1437777636 598 dbSNP
rs1362977255 601 dbSNP
rs1195363108 607 dbSNP
rs1396976395 610 dbSNP
rs775220917 612 dbSNP
rs1272141599 621 dbSNP
rs942433916 624 dbSNP
rs866994188 628 dbSNP
rs765719966 629 dbSNP
rs1364978158 635 dbSNP
rs1304305376 636 dbSNP
rs1445230297 638 dbSNP
rs1427068762 640 dbSNP
rs538385175 641 dbSNP
rs567660573 648 dbSNP
rs1231959380 650 dbSNP
rs1353240058 681 dbSNP
rs1272545569 683 dbSNP
rs1214752015 687 dbSNP
rs1170253287 693 dbSNP
rs1257208477 697 dbSNP
rs1456230801 697 dbSNP
rs1429472306 698 dbSNP
rs1421287580 703 dbSNP
rs1196747802 704 dbSNP
rs34514071 711 dbSNP
rs1450942974 712 dbSNP
rs759986841 714 dbSNP
rs1479830714 716 dbSNP
rs1423359114 719 dbSNP
rs951554669 720 dbSNP
rs1025792660 724 dbSNP
rs1464452469 733 dbSNP
rs1268913806 737 dbSNP
rs1386669874 740 dbSNP
rs1321043196 742 dbSNP
rs982811361 750 dbSNP
rs1201540490 752 dbSNP
rs1431024510 754 dbSNP
rs1277257423 757 dbSNP
rs970998444 761 dbSNP
rs549421285 762 dbSNP
rs545863304 767 dbSNP
rs1234960189 771 dbSNP
rs776736053 784 dbSNP
rs1205041467 797 dbSNP
rs1355596370 804 dbSNP
rs771044163 810 dbSNP
rs527703570 811 dbSNP
rs1012164378 820 dbSNP
rs893912134 823 dbSNP
rs1308969005 834 dbSNP
rs1194471969 837 dbSNP
rs1262813071 845 dbSNP
rs1275402871 845 dbSNP
rs1190558475 851 dbSNP
rs915831989 852 dbSNP
rs991386663 855 dbSNP
rs1161909597 861 dbSNP
rs747215370 864 dbSNP
rs563771464 865 dbSNP
rs560090812 866 dbSNP
rs1338020666 869 dbSNP
rs1416201560 885 dbSNP
rs1313187980 896 dbSNP
rs920644887 897 dbSNP
rs551295145 904 dbSNP
rs1262489636 905 dbSNP
rs962115031 914 dbSNP
rs1217499932 915 dbSNP
rs773487464 915 dbSNP
rs533047061 916 dbSNP
rs933934889 921 dbSNP
rs1257314957 923 dbSNP
rs901055656 926 dbSNP
rs1356580026 930 dbSNP
rs1366111840 933 dbSNP
rs1173837351 937 dbSNP
rs1440814602 938 dbSNP
rs187186022 943 dbSNP
rs558290758 945 dbSNP
rs1039390373 947 dbSNP
rs1436215286 950 dbSNP
rs1302997397 952 dbSNP
rs111468214 955 dbSNP
rs1178027822 956 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgucgacAGG-CGGGUCUGUg 5'
                 |||  |||  :|| 
Target 5' -------UCCUUCCCCUGCAa 3'
 		1 - 14
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000592984.1 | 3UTR | UCCUUCCCCUGCAACCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer 0.469 3.4e-3 0.389 1.4e-2 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.441 1.8e-2 -0.438 1.8e-2 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.425 1.9e-2 -0.459 1.2e-2 24 Click to see details
GSE28544 Breast cancer -0.36 4.2e-2 -0.319 6.4e-2 24 Click to see details
GSE28260 Renal cortex and medulla -0.452 6.0e-2 -0.462 5.6e-2 13 Click to see details
GSE21687 Ependynoma primary tumors -0.144 1.3e-1 -0.177 8.1e-2 64 Click to see details
GSE38226 Liver fibrosis -0.245 1.4e-1 -0.439 2.3e-2 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.214 1.8e-1 -0.057 4.1e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.163 2.2e-1 0.102 3.1e-1 25 Click to see details
GSE19350 CNS germ cell tumors -0.018 4.8e-1 0.460 6.6e-2 12 Click to see details
GSE17498 Multiple myeloma -0.008 4.8e-1 -0.050 3.8e-1 40 Click to see details
GSE17498 Multiple myeloma -0.008 4.8e-1 -0.050 3.8e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
37 hsa-miR-1231 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT075228 PHF13 PHD finger protein 13 2 6
MIRT266936 HDGF heparin binding growth factor 2 6
MIRT441394 SOX5 SRY-box 5 2 2
MIRT446329 ATP5C1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 2 2
MIRT446438 THYN1 thymocyte nuclear protein 1 2 2
MIRT482781 STIM1 stromal interaction molecule 1 2 2
MIRT497714 CYP1A1 cytochrome P450 family 1 subfamily A member 1 2 2
MIRT500907 STARD13 StAR related lipid transfer domain containing 13 2 2
MIRT503251 KIF18B kinesin family member 18B 2 2
MIRT504750 TEP1 telomerase associated protein 1 2 4
MIRT512158 CD164 CD164 molecule 2 6
MIRT518043 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 4
MIRT526038 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT529828 ARGFX arginine-fifty homeobox 2 2
MIRT531808 POLD3 DNA polymerase delta 3, accessory subunit 2 2
MIRT533139 WNT10A Wnt family member 10A 2 2
MIRT538612 CCT5 chaperonin containing TCP1 subunit 5 2 4
MIRT555617 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT561705 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT562301 GINM1 glycoprotein integral membrane 1 2 2
MIRT566732 MSH6 mutS homolog 6 2 2
MIRT569369 IMPG1 interphotoreceptor matrix proteoglycan 1 2 2
MIRT572314 HSPB6 heat shock protein family B (small) member 6 2 2
MIRT574602 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT612023 FOXF2 forkhead box F2 2 2
MIRT616950 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 2 2
MIRT624175 DERL2 derlin 2 2 2
MIRT647634 FAIM2 Fas apoptotic inhibitory molecule 2 2 2
MIRT659393 CORO2A coronin 2A 2 2
MIRT659955 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT684001 FOLR1 folate receptor 1 2 2
MIRT688143 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT688609 CYBRD1 cytochrome b reductase 1 2 2
MIRT693583 SLC39A1 solute carrier family 39 member 1 2 2
MIRT699922 RUFY2 RUN and FYVE domain containing 2 2 2
MIRT712961 PET117 PET117 homolog 2 2
MIRT723950 TMEM184A transmembrane protein 184A 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1231 Cisplatin 5460033 NSC119875 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-1231 Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-1231 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1231 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1231 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1231 Doxorubicin 31703 NSC123127 approved sensitive High Triple-Negative Breast Cancer cell line (MDA-MB-231, MDA-MB-468)
hsa-miR-1231 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1231 Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-1231 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-1231 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-mir-1231 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-1231 Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-mir-1231 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-mir-1231 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-1231 Cisplatin 5460033 NSC119875 approved resistant cell line (KYSE)
hsa-mir-1231 Fluorouracil 3385 NSC19893 approved sensitive cell line (KYSE)
hsa-mir-1231 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-1231 Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1231 Paclitaxel 36314 NSC125973 approved resistant cell line (HS578T)
hsa-miR-1231 Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-1231 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-1231 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-1231 Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-1231 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-1231 Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-1231 Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-1231 Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-1231 Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-1231 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1231 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-1231 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-1231 Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-1231 Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)

Error report submission