pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6132 |
Genomic Coordinates | chr7: 117020211 - 117020319 |
Description | Homo sapiens miR-6132 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6132 | |||||||||||||||
Sequence | 21| AGCAGGGCUGGGGAUUGCA |39 | |||||||||||||||
Evidence | Experimental | |||||||||||||||
Experiments | Illumina | |||||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | HSPB6 | ||||||||||||||||||||
Synonyms | HEL55, Hsp20, PPP1R91 | ||||||||||||||||||||
Description | heat shock protein family B (small) member 6 | ||||||||||||||||||||
Transcript | NM_144617 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on HSPB6 | |||||||||||||||||||||
3'UTR of HSPB6 (miRNA target sites are highlighted) |
>HSPB6|NM_144617|3'UTR 1 GAGGGGGCTGGGCCGCGCCCGCACCCCGGGAGCCTCCTCAGGCTCCCTCTATTAAAGCCGATCTGACTCCGCCCAGCCAG 81 ATGTCCCGAGTGCGCCAAGGACTGTCCTCTCACCCACTCCTGGATTCTGCCCTGACCTCCATCCTGGACACTGCCTTGAT 161 AACATAGACCCTTCCACTGACACCCTCGCTCTCACACCCCCTCCAGCTTTCCGACCCCACACCGACAACTCCCCGGCTTC 241 CAGACCCTACCAGCACTACCCTAACCCTCAGCCGACAGTCTCAGCCCCACCGACCCACTTTCTTGGCATATAGCCCCACT 321 TAAGACCCCTCCTCTACTTCCTTCTGAGTCCTCTACAAAGACATCCGGGTACTACATTTCCATCCCTTCCCTATTTTGAC 401 ACCAAATTATGGTGTAGACAGCCCTCCCCCAACCCCAGGCCAGTCAGGCACAATCCCCCCACCCCCCAAACGTCCTGGAC 481 TGCACAGACCTCCCACTCCAGACCATCCAGGCCTGGTTCCCAAGACCCGATCCTTCCCCTGCAACCAGACAGTCTACAAC 561 TGCCCCCTCCAGCCCATTTTCTGCCGTGAAACCCCAGCCAGCCACACCAGACTCTGGAACCCTTTTTCGACTGCCCCAAC 641 TCTTGGACACCAGGCCAACTAGAACACCCAACACCAAACTGTACAGACTCTCCCACCCCAACCTCCCCAGACTCTGCACG 721 GATGTCCTAGGCCCCCTCCCCAACTCTAACCAGACCCCATCCCCCTAAGTCCCTTTGTCTTGACCCCCAAGTCTTCAACC 801 AGATATCCTCGGCAACCCACCTCCCACCCTCCTCCTCTTCTCCTTCAAGACCCAACTGAGCACCCGCTCTGATTCCCCAC 881 AGCCTTTCTCCCTGCCACCACTCCCTTAGTCTTTCCCAGGCTTACTCTCCCAATAAATGTGCTAGAGCTCTGCCAAAAAA 961 AAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
CLIP-seq Support 1 for dataset GSM545213 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000592984.1 | 3UTR | UCCUUCCCCUGCAACCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
82 hsa-miR-6132 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT067294 | NECAP1 | NECAP endocytosis associated 1 | ![]() |
![]() |
2 | 10 | ||||||
MIRT100110 | ABT1 | activator of basal transcription 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT358583 | CANX | calnexin | ![]() |
![]() |
2 | 2 | ||||||
MIRT445247 | SEMA5A | semaphorin 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT445764 | CCND3 | cyclin D3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452388 | LY6E | lymphocyte antigen 6 family member E | ![]() |
![]() |
2 | 4 | ||||||
MIRT452829 | FAM131B | family with sequence similarity 131 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT453450 | GLG1 | golgi glycoprotein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455435 | ID3 | inhibitor of DNA binding 3, HLH protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT460629 | IGFBP4 | insulin like growth factor binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461607 | DPH2 | DPH2 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT461989 | PACSIN1 | protein kinase C and casein kinase substrate in neurons 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464258 | VCL | vinculin | ![]() |
![]() |
2 | 2 | ||||||
MIRT465713 | TNFAIP1 | TNF alpha induced protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466475 | TECPR2 | tectonin beta-propeller repeat containing 2 | ![]() |
![]() |
2 | 7 | ||||||
MIRT467119 | SRGAP1 | SLIT-ROBO Rho GTPase activating protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT468299 | SFT2D2 | SFT2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469696 | RAB5B | RAB5B, member RAS oncogene family | ![]() |
![]() |
2 | 8 | ||||||
MIRT469904 | PTRF | caveolae associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470015 | PTPLB | 3-hydroxyacyl-CoA dehydratase 2 | ![]() |
1 | 1 | |||||||
MIRT471385 | PDPR | pyruvate dehydrogenase phosphatase regulatory subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT471409 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471719 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT473608 | MARK2 | microtubule affinity regulating kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476328 | GLTSCR1L | BRD4 interacting chromatin remodeling complex associated protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT479448 | CDK6 | cyclin dependent kinase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482032 | AMER1 | APC membrane recruitment protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482360 | AGO2 | argonaute 2, RISC catalytic component | ![]() |
![]() |
2 | 2 | ||||||
MIRT484661 | HOXD3 | homeobox D3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT486828 | NDOR1 | NADPH dependent diflavin oxidoreductase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487069 | CLASP1 | cytoplasmic linker associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT487196 | NFASC | neurofascin | ![]() |
![]() |
2 | 4 | ||||||
MIRT487448 | TFAP2B | transcription factor AP-2 beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT487517 | GXYLT2 | glucoside xylosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487640 | BRSK2 | BR serine/threonine kinase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT487755 | SKI | SKI proto-oncogene | ![]() |
![]() |
2 | 4 | ||||||
MIRT489944 | CPLX1 | complexin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491101 | MSI1 | musashi RNA binding protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT491181 | LAMA5 | laminin subunit alpha 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492355 | SEMA7A | semaphorin 7A (John Milton Hagen blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT493918 | FAM127B | retrotransposon Gag like 8A | ![]() |
![]() |
2 | 4 | ||||||
MIRT493932 | FAM127A | retrotransposon Gag like 8C | ![]() |
![]() |
2 | 4 | ||||||
MIRT494679 | ARID3A | AT-rich interaction domain 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT494814 | AKAP11 | A-kinase anchoring protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT494835 | ADCY9 | adenylate cyclase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495455 | PNMAL2 | paraneoplastic Ma antigen family member 8B | ![]() |
![]() |
2 | 2 | ||||||
MIRT496962 | MAP1LC3B | microtubule associated protein 1 light chain 3 beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT526228 | MTRNR2L5 | MT-RNR2-like 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531028 | TDGF1P3 | teratocarcinoma-derived growth factor 1 pseudogene 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557110 | HOXA3 | homeobox A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560514 | POGK | pogo transposable element derived with KRAB domain | ![]() |
![]() |
2 | 2 | ||||||
MIRT567753 | DLC1 | DLC1 Rho GTPase activating protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT569608 | TRIM29 | tripartite motif containing 29 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570242 | CPNE5 | copine 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572327 | HSPB6 | heat shock protein family B (small) member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572373 | ATOX1 | antioxidant 1 copper chaperone | ![]() |
![]() |
2 | 2 | ||||||
MIRT575024 | Tecpr2 | tectonin beta-propeller repeat containing 2 | ![]() |
![]() |
2 | 5 | ||||||
MIRT576146 | Hmox1 | heme oxygenase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT612443 | SMOC2 | SPARC related modular calcium binding 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615404 | VDAC2 | voltage dependent anion channel 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629114 | CYCS | cytochrome c, somatic | ![]() |
![]() |
2 | 2 | ||||||
MIRT631362 | FOXI2 | forkhead box I2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639322 | THBD | thrombomodulin | ![]() |
![]() |
2 | 2 | ||||||
MIRT643797 | ABCC12 | ATP binding cassette subfamily C member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669687 | ABLIM1 | actin binding LIM protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670595 | LLGL1 | LLGL1, scribble cell polarity complex component | ![]() |
![]() |
2 | 4 | ||||||
MIRT691190 | NIF3L1 | NGG1 interacting factor 3 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691688 | FLOT2 | flotillin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697127 | OTUD5 | OTU deubiquitinase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700814 | PHLDA2 | pleckstrin homology like domain family A member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701248 | NUP35 | nucleoporin 35 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702362 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703325 | GDPD5 | glycerophosphodiester phosphodiesterase domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706060 | PKD1 | polycystin 1, transient receptor potential channel interacting | ![]() |
![]() |
2 | 2 | ||||||
MIRT710475 | CDH5 | cadherin 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713018 | SLC4A2 | solute carrier family 4 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716427 | RAB15 | RAB15, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT718093 | ABHD12 | abhydrolase domain containing 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718542 | PIGQ | phosphatidylinositol glycan anchor biosynthesis class Q | ![]() |
![]() |
2 | 2 | ||||||
MIRT719122 | CACFD1 | calcium channel flower domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721393 | LDLRAD4 | low density lipoprotein receptor class A domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT736283 | CDC42 | cell division cycle 42 | ![]() |
![]() |
2 | 0 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|