miRTarBase - #MIRT572583


—
pre-miRNA Information
pre-miRNA hsa-mir-7156   
Genomic Coordinates chr1: 77060143 - 77060202
Description Homo sapiens miR-7156 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7156-5p
Sequence 1| UUGUUCUCAAACUGGCUGUCAGA |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs907711107 9 dbSNP
rs940406061 22 dbSNP
Putative Targets

Gene Information
Gene Symbol HGFAC   
Synonyms HGFA
Description HGF activator
Transcript NM_001528   
Expression
Putative miRNA Targets on HGFAC
3'UTR of HGFAC
(miRNA target sites are highlighted)		 
>HGFAC|NM_001528|3'UTR
   1 CCCTCCAGCGGGACACCCTGGTTCCCACCATTCCCTGCCTTGCTGACAATAAAGATATTTCCAAGAACCCGGCCCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agacuGUCGGUCAA--ACUCUUGUu 5'
               | |||  ||  ||| ||:| 
Target 5' attccCTGCC--TTGCTGACAATAa 3'
 30 - 52 104.00 -6.53
2 
miRNA  3' agacugucggucaaacUCUUGUu 5'
                          :|:||| 
Target 5' -------ccctccagcGGGACAc 3'
 1 - 16 88.00 -7.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30652848 11 COSMIC
COSN26978731 15 COSMIC
COSN31539604 26 COSMIC
COSN30489071 29 COSMIC
COSN30473187 30 COSMIC
COSN30501337 36 COSMIC
COSN30459678 40 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1166173160 1 dbSNP
rs748845985 2 dbSNP
rs565214514 3 dbSNP
rs778729806 9 dbSNP
rs747909127 10 dbSNP
rs773548081 11 dbSNP
rs746949597 13 dbSNP
rs1186417836 15 dbSNP
rs770817808 18 dbSNP
rs776673005 22 dbSNP
rs371509874 27 dbSNP
rs368639189 30 dbSNP
rs1369872043 34 dbSNP
rs371586739 38 dbSNP
rs769966918 39 dbSNP
rs1363622520 40 dbSNP
rs575131797 43 dbSNP
rs763169583 48 dbSNP
rs1347965892 56 dbSNP
rs912979639 61 dbSNP
rs965531430 63 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agacugucggucaaacuCUUGUu 5'
                           ||||| 
Target 5' -----------------GAACAa 3'
 		1 - 6
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000382774.3 | 3UTR | GAACAAUGUAGGUAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
71 hsa-miR-7156-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT071889 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT089448 STAMBP STAM binding protein 2 2
MIRT135061 ADSS adenylosuccinate synthase 2 4
MIRT279713 EIF2S1 eukaryotic translation initiation factor 2 subunit alpha 2 4
MIRT314693 TMEM167A transmembrane protein 167A 2 2
MIRT405292 ARF1 ADP ribosylation factor 1 2 2
MIRT449941 IGF1 insulin like growth factor 1 2 2
MIRT450241 TRIM66 tripartite motif containing 66 2 2
MIRT450266 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT450683 RPN2 ribophorin II 2 2
MIRT465595 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT479853 CCDC6 coiled-coil domain containing 6 2 2
MIRT487158 IFRD1 interferon related developmental regulator 1 2 6
MIRT506338 NUP54 nucleoporin 54 2 4
MIRT514596 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 2 4
MIRT525340 TUBGCP4 tubulin gamma complex associated protein 4 2 2
MIRT528088 UCHL3 ubiquitin C-terminal hydrolase L3 2 2
MIRT529251 TRIM4 tripartite motif containing 4 2 4
MIRT552786 YAF2 YY1 associated factor 2 2 2
MIRT554463 SAMD12 sterile alpha motif domain containing 12 2 2
MIRT557667 GATA6 GATA binding protein 6 2 2
MIRT565808 SDCCAG3 serologically defined colon cancer antigen 3 2 2
MIRT566342 POLDIP2 DNA polymerase delta interacting protein 2 2 2
MIRT567793 DEK DEK proto-oncogene 2 2
MIRT572456 ZNF516 zinc finger protein 516 2 2
MIRT572583 HGFAC HGF activator 2 2
MIRT574650 LMAN2 lectin, mannose binding 2 2 2
MIRT608165 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT612019 PAK6 p21 (RAC1) activated kinase 6 2 8
MIRT616033 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT621925 SYAP1 synapse associated protein 1 2 4
MIRT624611 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT635086 AKIRIN1 akirin 1 2 2
MIRT636154 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT638256 SIX1 SIX homeobox 1 2 2
MIRT638485 NNT nicotinamide nucleotide transhydrogenase 2 2
MIRT639396 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT641787 USP32 ubiquitin specific peptidase 32 2 2
MIRT642300 FPR1 formyl peptide receptor 1 2 2
MIRT644555 SPOP speckle type BTB/POZ protein 2 2
MIRT645901 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT657250 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT659907 CACNG2 calcium voltage-gated channel auxiliary subunit gamma 2 2 2
MIRT665371 XIAP X-linked inhibitor of apoptosis 2 2
MIRT667268 NAV1 neuron navigator 1 2 2
MIRT669215 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT674142 ZNF793 zinc finger protein 793 2 2
MIRT698726 STX6 syntaxin 6 2 4
MIRT699789 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT700291 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT710005 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT710408 YTHDC1 YTH domain containing 1 2 2
MIRT710570 TNPO1 transportin 1 2 2
MIRT711055 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT711281 PSME3 proteasome activator subunit 3 2 2
MIRT711385 PLEKHG4B pleckstrin homology and RhoGEF domain containing G4B 2 2
MIRT712718 NCAPG2 non-SMC condensin II complex subunit G2 2 2
MIRT713289 ADAMTS20 ADAM metallopeptidase with thrombospondin type 1 motif 20 2 2
MIRT715650 USP6NL USP6 N-terminal like 2 2
MIRT716168 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT716757 TRABD2A TraB domain containing 2A 2 2
MIRT718362 SOX1 SRY-box 1 2 2
MIRT719672 SPDYE1 speedy/RINGO cell cycle regulator family member E1 2 2
MIRT720828 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT722185 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 2 2
MIRT722400 BCAS2 BCAS2, pre-mRNA processing factor 2 2
MIRT723461 ST8SIA3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 2 2
MIRT724073 NCKAP1L NCK associated protein 1 like 2 2
MIRT724595 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT725235 PDE1B phosphodiesterase 1B 2 2
MIRT725585 CDH7 cadherin 7 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-7156 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-7156-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-7156-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-7156-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission