miRTarBase - #MIRT574650


—
pre-miRNA Information
pre-miRNA hsa-mir-7156   
Genomic Coordinates chr1: 77060143 - 77060202
Description Homo sapiens miR-7156 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7156-5p
Sequence 1| UUGUUCUCAAACUGGCUGUCAGA |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs907711107 9 dbSNP
rs940406061 22 dbSNP
Putative Targets

Gene Information
Gene Symbol LMAN2   
Synonyms C5orf8, GP36B, VIP36
Description lectin, mannose binding 2
Transcript NM_006816   
Expression
Putative miRNA Targets on LMAN2
3'UTR of LMAN2
(miRNA target sites are highlighted)		 
>LMAN2|NM_006816|3'UTR
   1 GTGGCGCCTCCGGCGGGGCCTGTCCCTGGGCCCAGGAGCCAATGTGAACTTTTTTTTTTACCGGGATTATAAAAGAACAA
  81 CAAGATGACCTTATTTCTTAACTGTTTCAAATAAATGATTAAAGTATTTTCATACATTTTGCTTCTTGCCCAGCAGGGAC
 161 AGGTGGCAGAGCCGAGGCTTAGGGTCTGGCACCCCCCACAGCTGGAGACGGAGGCTCTCCTGGGGCTGGTGTCTCAGGAG
 241 CAGGGGTCTGTGTCTACAGATGGGCTGTGGCCCCTGCAGGCAGCTGTTGAACACTGGAGGGTCCCCCGGACCACACTGGG
 321 GTGGGCTCCTGAGGACGTGGGGAAGTGATTTTGTTTTGTGGTGTGTGGCACGTGTGGCGACGGATAAGGCCTGAACTGGG
 401 AAACCCAGGCCTTCCTGTTCACCCTGAGCTGCTTCCTGAGACAGATGCTCAAGTGAGGCTGCAGGCGCGGTGTGGTGGGG
 481 CCGAGTGTGACCGTTTGCTAAATAAAGTGAAATACCCAACCTCAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agacugucggucaaacUCUUGUu 5'
                          |||||| 
Target 5' ttaccgggattataaaAGAACAa 3'
 58 - 80 120.00 -9.82
2 
miRNA  3' agACUGUCGGUCAA--ACUCUUGUu 5'
            ||: :|: :| |  ||||:||: 
Target 5' acTGG-GGTGGGCTCCTGAGGACGt 3'
 315 - 338 118.00 -14.80
3 
miRNA  3' agaCUGUCGGUCAAACUCUUGUu 5'
             |:||||: |||   ||||| 
Target 5' gcaGGCAGCT-GTT---GAACAc 3'
 276 - 294 110.00 -12.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30141040 11 COSMIC
COSN31597934 36 COSMIC
COSN27314847 49 COSMIC
COSN15663755 50 COSMIC
COSN31543357 114 COSMIC
COSN32002611 117 COSMIC
COSN28190376 205 COSMIC
COSN31513048 270 COSMIC
COSN31555060 274 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs745780892 1 dbSNP
rs779034577 5 dbSNP
rs371052841 6 dbSNP
rs1205446959 7 dbSNP
rs572505982 10 dbSNP
rs755798382 11 dbSNP
rs560345996 12 dbSNP
rs781555446 14 dbSNP
rs147436495 15 dbSNP
rs374827953 21 dbSNP
rs1471271404 27 dbSNP
rs1207830503 28 dbSNP
rs370389140 29 dbSNP
rs1461046810 34 dbSNP
rs1343491084 35 dbSNP
rs1289683868 36 dbSNP
rs1052206690 40 dbSNP
rs766974485 42 dbSNP
rs1376568166 43 dbSNP
rs1285549059 48 dbSNP
rs762927423 49 dbSNP
rs1345883883 50 dbSNP
rs933838421 57 dbSNP
rs1306792969 60 dbSNP
rs551174424 60 dbSNP
rs574767266 61 dbSNP
rs990138173 62 dbSNP
rs1159069821 63 dbSNP
rs1487653833 75 dbSNP
rs1190808168 83 dbSNP
rs957966143 87 dbSNP
rs528303894 88 dbSNP
rs942660420 89 dbSNP
rs1423555670 92 dbSNP
rs1429614407 98 dbSNP
rs1170614730 109 dbSNP
rs1030835155 129 dbSNP
rs977902190 130 dbSNP
rs188233131 131 dbSNP
rs1214043461 135 dbSNP
rs1365765983 136 dbSNP
rs965177310 137 dbSNP
rs909874868 145 dbSNP
rs1489092452 156 dbSNP
rs1361273358 158 dbSNP
rs1215060531 161 dbSNP
rs1297878705 170 dbSNP
rs1019361935 173 dbSNP
rs1286261748 174 dbSNP
rs1007034105 188 dbSNP
rs889491543 193 dbSNP
rs1437185880 194 dbSNP
rs1209929172 196 dbSNP
rs1310804073 197 dbSNP
rs1304058129 198 dbSNP
rs369994680 209 dbSNP
rs11541332 210 dbSNP
rs1486502632 212 dbSNP
rs11541331 213 dbSNP
rs1188775566 228 dbSNP
rs1412194432 232 dbSNP
rs995161640 237 dbSNP
rs1339966371 242 dbSNP
rs1276339247 256 dbSNP
rs1426163038 260 dbSNP
rs897415962 263 dbSNP
rs1401888230 270 dbSNP
rs1361467454 271 dbSNP
rs576399117 277 dbSNP
rs1325073241 286 dbSNP
rs557985654 288 dbSNP
rs938869659 289 dbSNP
rs753469588 298 dbSNP
rs8119 301 dbSNP
rs1178153933 302 dbSNP
rs565782100 307 dbSNP
rs6877108 308 dbSNP
rs990557957 311 dbSNP
rs1447956427 319 dbSNP
rs934628277 319 dbSNP
rs1001954601 326 dbSNP
rs1236233257 327 dbSNP
rs1461254602 331 dbSNP
rs923894770 335 dbSNP
rs865901072 336 dbSNP
rs965208424 337 dbSNP
rs1406743958 344 dbSNP
rs892355054 353 dbSNP
rs11541333 356 dbSNP
rs3088072 358 dbSNP
rs1357414500 359 dbSNP
rs1451816097 368 dbSNP
rs1263538864 371 dbSNP
rs1019853484 375 dbSNP
rs183587128 378 dbSNP
rs760392396 379 dbSNP
rs377461329 381 dbSNP
rs1258086113 382 dbSNP
rs117704109 391 dbSNP
rs1317877785 392 dbSNP
rs531928591 393 dbSNP
rs1204842654 400 dbSNP
rs758121070 405 dbSNP
rs1220607277 406 dbSNP
rs1015875922 407 dbSNP
rs1178969644 416 dbSNP
rs1231971033 416 dbSNP
rs1003111323 419 dbSNP
rs1312279033 422 dbSNP
rs1394451426 423 dbSNP
rs1376745726 424 dbSNP
rs984106045 430 dbSNP
rs929981801 431 dbSNP
rs1470108681 439 dbSNP
rs1399539551 440 dbSNP
rs1168441339 446 dbSNP
rs1466737264 452 dbSNP
rs1373096049 453 dbSNP
rs1163665389 456 dbSNP
rs1408156956 460 dbSNP
rs907423252 460 dbSNP
rs1044976188 462 dbSNP
rs1257793788 463 dbSNP
rs3190259 463 dbSNP
rs1273494896 465 dbSNP
rs564392416 466 dbSNP
rs142842960 467 dbSNP
rs1265551604 468 dbSNP
rs113978759 469 dbSNP
rs761638778 475 dbSNP
rs1271672687 478 dbSNP
rs1438083610 482 dbSNP
rs527849058 483 dbSNP
rs1206153041 490 dbSNP
rs774251397 492 dbSNP
rs1054537060 493 dbSNP
rs960313957 496 dbSNP
rs1474377473 502 dbSNP
rs1167452251 511 dbSNP
rs1157975823 512 dbSNP
rs1397275909 514 dbSNP
rs1411684039 517 dbSNP
rs191760092 519 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000515209.1 | 3UTR | AACUUUUUUUUUUACCGGGAUUAUAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
71 hsa-miR-7156-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT071889 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT089448 STAMBP STAM binding protein 2 2
MIRT135061 ADSS adenylosuccinate synthase 2 4
MIRT279713 EIF2S1 eukaryotic translation initiation factor 2 subunit alpha 2 4
MIRT314693 TMEM167A transmembrane protein 167A 2 2
MIRT405292 ARF1 ADP ribosylation factor 1 2 2
MIRT449941 IGF1 insulin like growth factor 1 2 2
MIRT450241 TRIM66 tripartite motif containing 66 2 2
MIRT450266 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT450683 RPN2 ribophorin II 2 2
MIRT465595 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT479853 CCDC6 coiled-coil domain containing 6 2 2
MIRT487158 IFRD1 interferon related developmental regulator 1 2 6
MIRT506338 NUP54 nucleoporin 54 2 4
MIRT514596 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 2 4
MIRT525340 TUBGCP4 tubulin gamma complex associated protein 4 2 2
MIRT528088 UCHL3 ubiquitin C-terminal hydrolase L3 2 2
MIRT529251 TRIM4 tripartite motif containing 4 2 4
MIRT552786 YAF2 YY1 associated factor 2 2 2
MIRT554463 SAMD12 sterile alpha motif domain containing 12 2 2
MIRT557667 GATA6 GATA binding protein 6 2 2
MIRT565808 SDCCAG3 serologically defined colon cancer antigen 3 2 2
MIRT566342 POLDIP2 DNA polymerase delta interacting protein 2 2 2
MIRT567793 DEK DEK proto-oncogene 2 2
MIRT572456 ZNF516 zinc finger protein 516 2 2
MIRT572583 HGFAC HGF activator 2 2
MIRT574650 LMAN2 lectin, mannose binding 2 2 2
MIRT608165 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT612019 PAK6 p21 (RAC1) activated kinase 6 2 8
MIRT616033 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT621925 SYAP1 synapse associated protein 1 2 4
MIRT624611 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT635086 AKIRIN1 akirin 1 2 2
MIRT636154 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT638256 SIX1 SIX homeobox 1 2 2
MIRT638485 NNT nicotinamide nucleotide transhydrogenase 2 2
MIRT639396 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT641787 USP32 ubiquitin specific peptidase 32 2 2
MIRT642300 FPR1 formyl peptide receptor 1 2 2
MIRT644555 SPOP speckle type BTB/POZ protein 2 2
MIRT645901 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT657250 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT659907 CACNG2 calcium voltage-gated channel auxiliary subunit gamma 2 2 2
MIRT665371 XIAP X-linked inhibitor of apoptosis 2 2
MIRT667268 NAV1 neuron navigator 1 2 2
MIRT669215 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT674142 ZNF793 zinc finger protein 793 2 2
MIRT698726 STX6 syntaxin 6 2 4
MIRT699789 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT700291 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT710005 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT710408 YTHDC1 YTH domain containing 1 2 2
MIRT710570 TNPO1 transportin 1 2 2
MIRT711055 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT711281 PSME3 proteasome activator subunit 3 2 2
MIRT711385 PLEKHG4B pleckstrin homology and RhoGEF domain containing G4B 2 2
MIRT712718 NCAPG2 non-SMC condensin II complex subunit G2 2 2
MIRT713289 ADAMTS20 ADAM metallopeptidase with thrombospondin type 1 motif 20 2 2
MIRT715650 USP6NL USP6 N-terminal like 2 2
MIRT716168 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT716757 TRABD2A TraB domain containing 2A 2 2
MIRT718362 SOX1 SRY-box 1 2 2
MIRT719672 SPDYE1 speedy/RINGO cell cycle regulator family member E1 2 2
MIRT720828 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT722185 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 2 2
MIRT722400 BCAS2 BCAS2, pre-mRNA processing factor 2 2
MIRT723461 ST8SIA3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 2 2
MIRT724073 NCKAP1L NCK associated protein 1 like 2 2
MIRT724595 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT725235 PDE1B phosphodiesterase 1B 2 2
MIRT725585 CDH7 cadherin 7 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-7156 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-7156-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-7156-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-7156-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission