pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6867 |
Genomic Coordinates | chr17: 40193597 - 40193663 |
Description | Homo sapiens miR-6867 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6867-3p | ||||||||||||||||||||||||||||||
Sequence | 47| CUCUCCCUCUUUACCCACUAG |67 | ||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||
Experiments | Meta-analysis | DRVs in miRNA |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Mapk8ip2 | ||||||||||||||||||||
Synonyms | 3230402N03Rik, AI847694, AW049958, IB2, Jip2, R75148 | ||||||||||||||||||||
Description | mitogen-activated protein kinase 8 interacting protein 2 | ||||||||||||||||||||
Transcript | NM_021921 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Mapk8ip2 | |||||||||||||||||||||
3'UTR of Mapk8ip2 (miRNA target sites are highlighted) |
>Mapk8ip2|NM_021921|3'UTR 1 CAGCCACCTCCCTCAGCTCCCATCTACACAGCTCTGAGTATCTCAAGGCCACTGTGGCTTGAGCAAGGACTGGATCGGGG 81 ACATTTGGAACCTTACGTTGTGGGAGTCTCTGGGCTGGGAACTTTTCTCCTTTATCCCCAGGTCATGGCTTTTGGGAGCT 161 GTTTGGGGAGAGGAGCCTCAGCAGCCATATTTTTCTTCCGATGCATCTTTCCCTCTCCTGTCCTCATTTGTCCCGTTCCC 241 TCCGACGGCCTTTCCTCTGTCTCTCGCCCCCTCTCTGTGCCTGTAGACCTTGCTCTTTGCTCTCTCTTTGGGAGGCAGAA 321 CTTTGAGGGAGGGGAGTAGGCTCAAGGTAACCGATGAAGTCAGGTTCCCTCCAGTGGTTCCCTCCTGCCCTTCTCTTGTG 401 ATTTATAAATGAATTTTAATTTTTATAGTGAATCTCAAGGGATCGTCCCACCTTTGATCACAGGAAGGGATCCTAGCCCC 481 CAAACTCACAAGGAGCTCGGGAAGGAGGGGGAGAGGGGTTTCTAAGAGAACCTTAGGATAACTAGGTGGTTCTTGATGCT 561 CACCCAAAGCCCCCAATGCTGCTAGGAGGAGGGCACCCCCAAAGGGTGCTCCCCACAGGCCATCTGCTTTTGCCGCTAAC 641 ACCCCTTCAGTCCAGCGAGTATCTGCCCTGCGTGCTGCCACCTGCTGTGTACGTGGGCCCCGCCCCCACGGCATCAATAA 721 ACTCTGCTTGGTGTGAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | TrHBMEC |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP聽 data was present in GSM1013112. RNA binding protein: AGO. Condition:TrHBMEC-replicate-1
... - Balakrishnan I; Yang X; Brown J; et al., 2014, Stem cells (Dayton, Ohio). |
Article |
- Balakrishnan I; Yang X; Brown J; et al. - Stem cells (Dayton, Ohio), 2014
Regulation of hematopoietic stem cell proliferation, lineage commitment, and differentiation in adult vertebrates requires extrinsic signals provided by cells in the marrow microenvironment (ME) located within the bone marrow. Both secreted and cell-surface bound factors critical to this regulation have been identified, yet control of their expression by cells within the ME has not been addressed. Herein we hypothesize that microRNAs (miRNAs) contribute to their controlled expression. MiRNAs are small noncoding RNAs that bind to target mRNAs and downregulate gene expression by either initiating mRNA degradation or preventing peptide translation. Testing the role of miRNAs in downregulating gene expression has been difficult since conventional techniques used to define miRNA-mRNA interactions are indirect and have high false-positive and negative rates. In this report, a genome-wide biochemical technique (high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation or HITS-CLIP) was used to generate unbiased genome-wide maps of miRNA-mRNA interactions in two critical cellular components of the marrow ME: marrow stromal cells and bone marrow endothelial cells. Analysis of these datasets identified miRNAs as direct regulators of JAG1, WNT5A, MMP2, and VEGFA; four factors that are important to ME function. Our results show the feasibility and utility of unbiased genome-wide biochemical techniques in dissecting the role of miRNAs in regulation of complex tissues such as the marrow ME.
LinkOut: [PMID: 24038734]
|
CLIP-seq Support 1 for dataset GSM1013112 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | TrHBMEC / TrHBMEC-replicate-1 |
Location of target site | ENST00000399908.2 | 3UTR | AAGAUUGCACCACUGCACUCCAGCCUGGGCGACAGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24038734 / GSE41272 |
CLIP-seq Viewer | Link |
203 hsa-miR-6867-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT078229 | DYNLL2 | dynein light chain LC8-type 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT107799 | SLC1A1 | solute carrier family 1 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT115808 | CAPN15 | calpain 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT137570 | RCOR1 | REST corepressor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT161372 | MBNL1 | muscleblind like splicing regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT320477 | HOXA10 | homeobox A10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444449 | PTPRG | protein tyrosine phosphatase, receptor type G | ![]() |
![]() |
2 | 2 | ||||||
MIRT461305 | MRPS27 | mitochondrial ribosomal protein S27 | ![]() |
![]() |
2 | 6 | ||||||
MIRT470306 | PPP6R1 | protein phosphatase 6 regulatory subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471679 | PABPN1 | poly(A) binding protein nuclear 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475546 | HNRNPUL1 | heterogeneous nuclear ribonucleoprotein U like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480901 | BCL2L2-PABPN1 | BCL2L2-PABPN1 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT489368 | RAB11B | RAB11B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT489557 | PLD6 | phospholipase D family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT494969 | TMEM233 | transmembrane protein 233 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496634 | SLC46A1 | solute carrier family 46 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500259 | ZNF788 | zinc finger family member 788 | ![]() |
![]() |
2 | 6 | ||||||
MIRT500272 | ZNF781 | zinc finger protein 781 | ![]() |
![]() |
2 | 8 | ||||||
MIRT500328 | ZNF487P | zinc finger protein 487 | ![]() |
1 | 3 | |||||||
MIRT504012 | ACSL6 | acyl-CoA synthetase long chain family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504830 | EREG | epiregulin | ![]() |
![]() |
2 | 2 | ||||||
MIRT513588 | DCTN6 | dynactin subunit 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520896 | STMN1 | stathmin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT525275 | C18orf32 | chromosome 18 open reading frame 32 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526166 | ANKRD65 | ankyrin repeat domain 65 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526582 | CCDC43 | coiled-coil domain containing 43 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527812 | TMEM74B | transmembrane protein 74B | ![]() |
![]() |
2 | 2 | ||||||
MIRT528141 | LRRC38 | leucine rich repeat containing 38 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529903 | C1orf64 | steroid receptor associated and regulated protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT531980 | SLCO1B3 | solute carrier organic anion transporter family member 1B3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT532251 | TBPL2 | TATA-box binding protein like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534300 | SKIDA1 | SKI/DACH domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534879 | QKI | QKI, KH domain containing RNA binding | ![]() |
![]() |
2 | 2 | ||||||
MIRT538305 | CSNK2A1 | casein kinase 2 alpha 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539385 | ADRB1 | adrenoceptor beta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541304 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543960 | RNF20 | ring finger protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544380 | ZNF266 | zinc finger protein 266 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544451 | KRBOX4 | KRAB box domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545783 | ZNF791 | zinc finger protein 791 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548156 | FRAT2 | FRAT2, WNT signaling pathway regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT556660 | KMT2D | lysine methyltransferase 2D | ![]() |
![]() |
2 | 4 | ||||||
MIRT557715 | GABARAPL1 | GABA type A receptor associated protein like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562701 | ZNF415 | zinc finger protein 415 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563050 | ZNF138 | zinc finger protein 138 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564307 | CCNT1 | cyclin T1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568333 | BACH1 | BTB domain and CNC homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570864 | ZNF525 | zinc finger protein 525 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570874 | ZFP1 | ZFP1 zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT571516 | ZNF625 | zinc finger protein 625 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572470 | MTMR10 | myotubularin related protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572898 | RUNDC3B | RUN domain containing 3B | ![]() |
![]() |
2 | 2 | ||||||
MIRT573084 | APLN | apelin | ![]() |
![]() |
2 | 2 | ||||||
MIRT575251 | Timp3 | tissue inhibitor of metalloproteinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575275 | Mapk8ip2 | mitogen-activated protein kinase 8 interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607230 | LINS | lines homolog 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT611803 | FCRL4 | Fc receptor like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT612669 | POU2F1 | POU class 2 homeobox 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT612739 | MYOCD | myocardin | ![]() |
![]() |
2 | 2 | ||||||
MIRT613409 | CDH8 | cadherin 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT614007 | PAOX | polyamine oxidase | ![]() |
![]() |
2 | 2 | ||||||
MIRT615188 | CLUAP1 | clusterin associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT616497 | ATP6AP1L | ATPase H+ transporting accessory protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT616524 | URM1 | ubiquitin related modifier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617066 | SPIB | Spi-B transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT617813 | EMX2 | empty spiracles homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619291 | FAM26E | calcium homeostasis modulator family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619375 | KLHL12 | kelch like family member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619499 | TXLNB | taxilin beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT619601 | MKKS | McKusick-Kaufman syndrome | ![]() |
![]() |
2 | 2 | ||||||
MIRT619754 | MYO1F | myosin IF | ![]() |
![]() |
2 | 2 | ||||||
MIRT619976 | ZSCAN22 | zinc finger and SCAN domain containing 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620743 | CCR5 | C-C motif chemokine receptor 5 (gene/pseudogene) | ![]() |
![]() |
2 | 2 | ||||||
MIRT620871 | KCTD7 | potassium channel tetramerization domain containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621380 | CLNK | cytokine dependent hematopoietic cell linker | ![]() |
![]() |
2 | 2 | ||||||
MIRT621511 | ZNF638 | zinc finger protein 638 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621537 | ZNF500 | zinc finger protein 500 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621772 | TMEM87B | transmembrane protein 87B | ![]() |
![]() |
2 | 2 | ||||||
MIRT622193 | SLC5A12 | solute carrier family 5 member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622319 | SEC63 | SEC63 homolog, protein translocation regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT622738 | PITPNM3 | PITPNM family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622996 | ONECUT3 | one cut homeobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625301 | SHISA6 | shisa family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625637 | KCNQ3 | potassium voltage-gated channel subfamily Q member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627698 | RFFL | ring finger and FYVE like domain containing E3 ubiquitin protein ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT627751 | RAD51L3-RFFL | RAD51L3-RFFL readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT628438 | ANTXR2 | anthrax toxin receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635440 | SLC25A44 | solute carrier family 25 member 44 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637166 | TMEM50A | transmembrane protein 50A | ![]() |
![]() |
2 | 2 | ||||||
MIRT638207 | SPTLC2 | serine palmitoyltransferase long chain base subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639288 | TFAP2A | transcription factor AP-2 alpha | ![]() |
![]() |
2 | 4 | ||||||
MIRT639398 | NEURL1B | neuralized E3 ubiquitin protein ligase 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT641230 | SEMA3E | semaphorin 3E | ![]() |
![]() |
2 | 2 | ||||||
MIRT641501 | STC2 | stanniocalcin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642577 | PSTPIP1 | proline-serine-threonine phosphatase interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642735 | TDRD6 | tudor domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644001 | PPP1R3G | protein phosphatase 1 regulatory subunit 3G | ![]() |
![]() |
2 | 2 | ||||||
MIRT644210 | CBS | cystathionine-beta-synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT645405 | FAM110A | family with sequence similarity 110 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT645685 | TBC1D13 | TBC1 domain family member 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645699 | C1orf50 | chromosome 1 open reading frame 50 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645761 | SURF6 | surfeit 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645826 | INADL | PATJ, crumbs cell polarity complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT645914 | PLXNA3 | plexin A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT646167 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT646634 | COA4 | cytochrome c oxidase assembly factor 4 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT647547 | CYP2B6 | cytochrome P450 family 2 subfamily B member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648262 | ZNF582 | zinc finger protein 582 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648385 | ZNF22 | zinc finger protein 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648629 | LEMD2 | LEM domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649353 | SLC27A2 | solute carrier family 27 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649395 | SH2D4A | SH2 domain containing 4A | ![]() |
![]() |
2 | 2 | ||||||
MIRT650241 | CD68 | CD68 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT650379 | PTGIS | prostaglandin I2 synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT650705 | KRT32 | keratin 32 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650854 | UNC13D | unc-13 homolog D | ![]() |
![]() |
2 | 2 | ||||||
MIRT651042 | ZNF644 | zinc finger protein 644 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651102 | ZNF48 | zinc finger protein 48 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651130 | ZNF398 | zinc finger protein 398 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652089 | TSKU | tsukushi, small leucine rich proteoglycan | ![]() |
![]() |
2 | 2 | ||||||
MIRT652200 | TRIM33 | tripartite motif containing 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652422 | TMEM239 | transmembrane protein 239 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652755 | TET3 | tet methylcytosine dioxygenase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653201 | SP9 | Sp9 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT653338 | SMG7 | SMG7, nonsense mediated mRNA decay factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT653715 | SLC25A32 | solute carrier family 25 member 32 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654456 | RAP2B | RAP2B, member of RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT654499 | RABIF | RAB interacting factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT654678 | PSMB5 | proteasome subunit beta 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT655162 | PHF20L1 | PHD finger protein 20 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT655540 | PADI2 | peptidyl arginine deiminase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT655850 | NFE2L1 | nuclear factor, erythroid 2 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656248 | MEX3A | mex-3 RNA binding family member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT656581 | LSAMP | limbic system-associated membrane protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT657597 | GRID1 | glutamate ionotropic receptor delta type subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657824 | GJD3 | gap junction protein delta 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658466 | FAM102B | family with sequence similarity 102 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT659083 | DENR | density regulated re-initiation and release factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT659196 | CYBB | cytochrome b-245 beta chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT659558 | CGGBP1 | CGG triplet repeat binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659860 | CAPRIN1 | cell cycle associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660172 | BNC2 | basonuclin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660626 | ANKRD52 | ankyrin repeat domain 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660917 | ADAM19 | ADAM metallopeptidase domain 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660979 | ABHD2 | abhydrolase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661564 | EPHX2 | epoxide hydrolase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662214 | CCRL2 | C-C motif chemokine receptor like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662246 | C15orf52 | chromosome 15 open reading frame 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662560 | IL2RA | interleukin 2 receptor subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT662591 | MAGEB4 | MAGE family member B4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663294 | TECPR2 | tectonin beta-propeller repeat containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663437 | FBXO2 | F-box protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663811 | RNF128 | ring finger protein 128, E3 ubiquitin protein ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT663821 | NLRP12 | NLR family pyrin domain containing 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665959 | SZRD1 | SUZ RNA binding domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666115 | SRRM4 | serine/arginine repetitive matrix 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667448 | MAPK14 | mitogen-activated protein kinase 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669330 | BSND | barttin CLCNK type accessory beta subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT669409 | ATP9A | ATPase phospholipid transporting 9A (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT669641 | ACSBG1 | acyl-CoA synthetase bubblegum family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672663 | GTF2H5 | general transcription factor IIH subunit 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673266 | RUNDC1 | RUN domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676995 | CYP20A1 | cytochrome P450 family 20 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679290 | SSBP2 | single stranded DNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT687508 | NCKAP1 | NCK associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT698932 | SPATA2 | spermatogenesis associated 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700852 | PERP | PERP, TP53 apoptosis effector | ![]() |
![]() |
2 | 2 | ||||||
MIRT702426 | KIAA1958 | KIAA1958 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703939 | EPB41L1 | erythrocyte membrane protein band 4.1 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708962 | SLC12A3 | solute carrier family 12 member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709742 | UBD | ubiquitin D | ![]() |
![]() |
2 | 2 | ||||||
MIRT709946 | TRUB2 | TruB pseudouridine synthase family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711121 | CYYR1 | cysteine and tyrosine rich 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711217 | RETSAT | retinol saturase | ![]() |
![]() |
2 | 2 | ||||||
MIRT711576 | ASPA | aspartoacylase | ![]() |
![]() |
2 | 2 | ||||||
MIRT711599 | LHX5 | LIM homeobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712232 | RCC2 | regulator of chromosome condensation 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713317 | TMEM44 | transmembrane protein 44 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713510 | PAFAH2 | platelet activating factor acetylhydrolase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713543 | GJB1 | gap junction protein beta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713621 | MED8 | mediator complex subunit 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714988 | TSPAN11 | tetraspanin 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715449 | PTCD1 | pentatricopeptide repeat domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715575 | ATP5J2-PTCD1 | ATP5J2-PTCD1 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT715771 | DDX42 | DEAD-box helicase 42 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715887 | GNG2 | G protein subunit gamma 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716091 | HARS | histidyl-tRNA synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT717403 | ZCCHC24 | zinc finger CCHC-type containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717965 | PXMP4 | peroxisomal membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718324 | METTL7A | methyltransferase like 7A | ![]() |
![]() |
2 | 2 | ||||||
MIRT718628 | DIP2A | disco interacting protein 2 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT719213 | CAMK4 | calcium/calmodulin dependent protein kinase IV | ![]() |
![]() |
2 | 2 | ||||||
MIRT719234 | CYSLTR2 | cysteinyl leukotriene receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719817 | LRRC4 | leucine rich repeat containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719978 | MAPK1 | mitogen-activated protein kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720480 | TMEM178B | transmembrane protein 178B | ![]() |
![]() |
2 | 2 | ||||||
MIRT720713 | RAPGEF6 | Rap guanine nucleotide exchange factor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721006 | ZNF619 | zinc finger protein 619 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721741 | SDK2 | sidekick cell adhesion molecule 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723547 | ZDHHC22 | zinc finger DHHC-type containing 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723596 | FKRP | fukutin related protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT723746 | AIFM2 | apoptosis inducing factor, mitochondria associated 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724784 | C1D | C1D nuclear receptor corepressor | ![]() |
![]() |
2 | 2 |