miRTarBase - #MIRT575328


—
pre-miRNA Information
pre-miRNA hsa-mir-215   
Genomic Coordinates chr1: 220117853 - 220117962
Synonyms MIRN215, miRNA215, mir-215, MIR215
Description Homo sapiens miR-215 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-215-3p
Sequence 64| UCUGUCAUUUCUUUAGGCCAAUA |86
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs768393822 2 dbSNP
rs1345487830 5 dbSNP
rs757646667 7 dbSNP
rs754286532 11 dbSNP
rs749489380 17 dbSNP
rs1333471638 18 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Gene Information
Gene Symbol Fbxo6   
Synonyms AA408845, FBG2, Fbs2, Fbx6b, Fbxo6b
Description F-box protein 6
Transcript NM_001163704   
Other Transcripts NM_001163705 , NM_001163706 , NM_001163707 , NM_015797   
Expression
Putative miRNA Targets on Fbxo6
3'UTR of Fbxo6
(miRNA target sites are highlighted)		 
>Fbxo6|NM_001163704|3'UTR
   1 TGGGCAGTCAGGCTCCCAGTCCCATGAGCACTTGCCCTATACAACCTTGGGCAAGCCCATCAACTCAGTAGTGATAGTTG
  81 GCACCCACAGCTCTGACATTTTGTTGTAATAAATGTTTTCAGTAACCCAGCCTGGTTTGAGGGCTTACAGGTGGGTTGCT
 161 GGCACTCTGAGAAAGAGCCCCTTCTCAGGGCAGCTTCGAT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' auaaccggauuUCUUUACUGUCu 5'
                     || |:|||:|| 
Target 5' cccatcaactcAGTAGTGATAGt 3'
 56 - 78 120.00 -8.70
2 
miRNA  3' auaACCGGAUUUCUUUACUGUCu 5'
             |||::| :||:: | |||| 
Target 5' gccTGGTTT-GAGGGCTTACAGg 3'
 130 - 151 103.00 -14.60
3 
miRNA  3' auaACCG---GA---UUUCUU---------UACUGUCu 5'
             ||||   ||   |||||:         | |:||| 
Target 5' tgcTGGCACTCTGAGAAAGAGCCCCTTCTCAGGGCAGc 3'
 157 - 194 100.00 -16.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TrHBMEC
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP聽 data was present in GSM1013112. RNA binding protein: AGO. Condition:TrHBMEC-replicate-1 ...

- Balakrishnan I; Yang X; Brown J; et al., 2014, Stem cells (Dayton, Ohio).

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' auaACCGGAUUUC---UUUACUGUCu 5'
             ||  ||  ||   :::|||||| 
Target 5' cacUGCACUCCAGCCUGGGUGACAGa 3'
 		11 - 36
Article - Balakrishnan I; Yang X; Brown J; et al.
- Stem cells (Dayton, Ohio), 2014
Regulation of hematopoietic stem cell proliferation, lineage commitment, and differentiation in adult vertebrates requires extrinsic signals provided by cells in the marrow microenvironment (ME) located within the bone marrow. Both secreted and cell-surface bound factors critical to this regulation have been identified, yet control of their expression by cells within the ME has not been addressed. Herein we hypothesize that microRNAs (miRNAs) contribute to their controlled expression. MiRNAs are small noncoding RNAs that bind to target mRNAs and downregulate gene expression by either initiating mRNA degradation or preventing peptide translation. Testing the role of miRNAs in downregulating gene expression has been difficult since conventional techniques used to define miRNA-mRNA interactions are indirect and have high false-positive and negative rates. In this report, a genome-wide biochemical technique (high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation or HITS-CLIP) was used to generate unbiased genome-wide maps of miRNA-mRNA interactions in two critical cellular components of the marrow ME: marrow stromal cells and bone marrow endothelial cells. Analysis of these datasets identified miRNAs as direct regulators of JAG1, WNT5A, MMP2, and VEGFA; four factors that are important to ME function. Our results show the feasibility and utility of unbiased genome-wide biochemical techniques in dissecting the role of miRNAs in regulation of complex tissues such as the marrow ME.
LinkOut: [PMID: 24038734]
CLIP-seq Support 1 for dataset GSM1013112
Method / RBP HITS-CLIP  / AGO
Cell line / Condition TrHBMEC / TrHBMEC-replicate-1
Location of target site ENST00000376753.4 | 3UTR | GAGAUCACGCCACUGCACUCCAGCCUGGGUGACAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24038734 / GSE41272
CLIP-seq Viewer Link
96 hsa-miR-215-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT058509 TEAD1 TEA domain transcription factor 1 2 2
MIRT445625 TMEM50A transmembrane protein 50A 2 2
MIRT449286 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT456702 LDB1 LIM domain binding 1 2 2
MIRT467723 SLC38A1 solute carrier family 38 member 1 2 2
MIRT474253 LATS2 large tumor suppressor kinase 2 2 2
MIRT481811 AP4E1 adaptor related protein complex 4 epsilon 1 subunit 2 2
MIRT491969 USP37 ubiquitin specific peptidase 37 2 2
MIRT513203 RFT1 RFT1 homolog 2 2
MIRT532737 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT535706 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT536138 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT536463 KLF12 Kruppel like factor 12 2 4
MIRT552615 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT554011 SPIRE1 spire type actin nucleation factor 1 2 2
MIRT563259 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 2
MIRT571054 POLQ DNA polymerase theta 2 4
MIRT573556 TMEM120B transmembrane protein 120B 2 2
MIRT573772 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 2 2
MIRT575328 Fbxo6 F-box protein 6 2 2
MIRT575497 Sept3 septin 3 2 5
MIRT607051 IDS iduronate 2-sulfatase 2 2
MIRT607070 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607497 HEBP2 heme binding protein 2 2 2
MIRT607799 RHBDL2 rhomboid like 2 2 2
MIRT610832 COL9A1 collagen type IX alpha 1 chain 2 2
MIRT616853 DSG2 desmoglein 2 2 2
MIRT617154 C18orf42 A-kinase anchor inhibitor 1 2 2
MIRT620823 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 1 1
MIRT625698 OPTN optineurin 2 2
MIRT628082 KAT7 lysine acetyltransferase 7 2 2
MIRT633540 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634343 SGOL1 shugoshin 1 2 2
MIRT634605 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT636759 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637044 SEPT3 septin 3 2 7
MIRT637213 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT639634 ZSCAN23 zinc finger and SCAN domain containing 23 2 2
MIRT640818 GPR107 G protein-coupled receptor 107 2 2
MIRT641033 PITPNB phosphatidylinositol transfer protein beta 2 2
MIRT641545 MOCOS molybdenum cofactor sulfurase 2 2
MIRT642091 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT645528 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT647017 ADCY2 adenylate cyclase 2 2 2
MIRT648044 FADS6 fatty acid desaturase 6 2 2
MIRT648514 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648869 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT656722 LMLN leishmanolysin like peptidase 2 2
MIRT658260 FAXC failed axon connections homolog 2 2
MIRT659063 DEPTOR DEP domain containing MTOR interacting protein 2 2
MIRT659364 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT660318 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT663345 ZNF74 zinc finger protein 74 2 2
MIRT663526 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663975 ZNF786 zinc finger protein 786 2 2
MIRT664354 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664473 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664975 TDRD1 tudor domain containing 1 2 2
MIRT665488 VPS53 VPS53, GARP complex subunit 2 2
MIRT667758 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT669552 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT670183 CCDC142 coiled-coil domain containing 142 2 2
MIRT671342 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT671873 ZNF429 zinc finger protein 429 2 2
MIRT672018 PXMP4 peroxisomal membrane protein 4 2 2
MIRT672068 KIAA0930 KIAA0930 2 2
MIRT672551 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT672849 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT672988 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT673088 AK1 adenylate kinase 1 2 2
MIRT673578 KDELC2 KDEL motif containing 2 2 2
MIRT674582 SLC35B4 solute carrier family 35 member B4 2 2
MIRT674999 STRN3 striatin 3 2 2
MIRT675596 ZNF106 zinc finger protein 106 2 2
MIRT675778 YIPF4 Yip1 domain family member 4 2 2
MIRT676029 C9orf69 transmembrane protein 250 2 2
MIRT679015 MTMR10 myotubularin related protein 10 2 2
MIRT679169 PSMB2 proteasome subunit beta 2 2 2
MIRT687413 NRIP1 nuclear receptor interacting protein 1 2 2
MIRT688038 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT691644 SLC43A3 solute carrier family 43 member 3 2 2
MIRT695630 SLC26A2 solute carrier family 26 member 2 2 2
MIRT697562 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT699153 SMC1A structural maintenance of chromosomes 1A 2 2
MIRT699683 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT702177 LYRM4 LYR motif containing 4 2 2
MIRT706217 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT711243 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT712343 NLN neurolysin 2 2
MIRT716574 HOPX HOP homeobox 2 2
MIRT717443 TENM1 teneurin transmembrane protein 1 2 2
MIRT717759 KCNRG potassium channel regulator 2 2
MIRT717945 TUBD1 tubulin delta 1 2 2
MIRT718343 PURA purine rich element binding protein A 2 2
MIRT718773 ABHD15 abhydrolase domain containing 15 2 2
MIRT737073 FOXM1 forkhead box M1 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-215 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-215 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-215 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-215 Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miR-215 Furan NULL 8029 Quantitative real-time PCR liver 22079235 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-215 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-215 Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-mir-215 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-215-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colon Cancer cell line (HCT-116)
hsa-miR-215-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-215-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)

Error report submission