>Mcm8|NM_025676|3'UTR
   1 AAGACTTTACCACATCAGGGCTTCCTGTGGTTCAAAATAGTTCAGAATCATCGTAATTACAAAACTGAAAATAAAAGTTC
  81 TGAAAAATGACACAACTCCTATAACAGAATAAAGGCCTATCCATAATTTATCCAGAAGAGTAAGAAGAGTAAATTGTTTC
 161 CATTATTTTATCTAAATAGCATAAGCATATGCTTTTAACTCATCATATTTTTAGTAGTGCTTTTTAGTTTTGTATATCAG
 241 ATGTCTAGCAGGCATTCAGCTAATGCAAAAACAGATTAGTATGTGTTCAGGTGAACTTTTACTTAAAACATTAAACTTTG
 321 GCTCTCCTAAATTGTTCAGGTCACAAAAACTCTTCATTCATTTTTAACTTTATGATTATGGGCAGTGGGTCTGACTTGGC
 401 TTCTCATTTGAAAGTAGTGGAAATTTATTGACTTAATTAGAAGTCTTTTCTGGGGCTAGAGAGATGACTCAGTGGTTAAG
 481 AGCACTGACTGCTCTTCCATAGGTCCTGAGTTCAAGTCCCAGCAACCACATGGTGACTCACAACCATCTGTAATGGGATC
 561 CAATGCCCTCTTCTCGTGTCTCTGAAGAGAGTAACAGTGCACTCACATAAATAAATCTTAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' acAUGUCGUC--CG---UGUCUGUcc 5' ||:| ||| |: :|||:|| Target 5' tgTATATCAGATGTCTAGCAGGCAtt 3'	231 - 256	117.00	-16.66
2	miRNA 3' acAUGUCGUCCGUGUCU-GUCc 5' || ||| ||||| :|| Target 5' gcTAATGCAAAAACAGATTAGt 3'	259 - 280	107.00	-7.60
3	miRNA 3' acAUGUCGUCCGUGUCUGUCc 5' | | | :||| :||| || Target 5' ttTTCTG-GGGC-TAGAGAGa 3'	446 - 464	101.00	-8.70

- Stem cells (Dayton, Ohio), 2014

Regulation of hematopoietic stem cell proliferation, lineage commitment, and differentiation in adult vertebrates requires extrinsic signals provided by cells in the marrow microenvironment (ME) located within the bone marrow. Both secreted and cell-surface bound factors critical to this regulation have been identified, yet control of their expression by cells within the ME has not been addressed. Herein we hypothesize that microRNAs (miRNAs) contribute to their controlled expression. MiRNAs are small noncoding RNAs that bind to target mRNAs and downregulate gene expression by either initiating mRNA degradation or preventing peptide translation. Testing the role of miRNAs in downregulating gene expression has been difficult since conventional techniques used to define miRNA-mRNA interactions are indirect and have high false-positive and negative rates. In this report, a genome-wide biochemical technique (high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation or HITS-CLIP) was used to generate unbiased genome-wide maps of miRNA-mRNA interactions in two critical cellular components of the marrow ME: marrow stromal cells and bone marrow endothelial cells. Analysis of these datasets identified miRNAs as direct regulators of JAG1, WNT5A, MMP2, and VEGFA; four factors that are important to ME function. Our results show the feasibility and utility of unbiased genome-wide biochemical techniques in dissecting the role of miRNAs in regulation of complex tissues such as the marrow ME.

- Nucleic acids research, 2016

MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.