miRTarBase - #MIRT575849


—
pre-miRNA Information
pre-miRNA hsa-mir-452   
Genomic Coordinates chrX: 151959628 - 151959712
Synonyms MIRN452, hsa-mir-452, MIR452
Description Homo sapiens miR-452 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-452-3p
Sequence 58| CUCAUCUGCAAAGAAGUAAGUG |79
Evidence Experimental
Experiments Array-cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 X - 151959644 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs757928550 3 dbSNP
rs1324216965 6 dbSNP
rs1390793899 13 dbSNP
rs899383242 17 dbSNP
rs747858567 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Gene Information
Gene Symbol Rab1
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Balakrishnan I; Yang X; Brown J; et al.
- Stem cells (Dayton, Ohio), 2014
Regulation of hematopoietic stem cell proliferation, lineage commitment, and differentiation in adult vertebrates requires extrinsic signals provided by cells in the marrow microenvironment (ME) located within the bone marrow. Both secreted and cell-surface bound factors critical to this regulation have been identified, yet control of their expression by cells within the ME has not been addressed. Herein we hypothesize that microRNAs (miRNAs) contribute to their controlled expression. MiRNAs are small noncoding RNAs that bind to target mRNAs and downregulate gene expression by either initiating mRNA degradation or preventing peptide translation. Testing the role of miRNAs in downregulating gene expression has been difficult since conventional techniques used to define miRNA-mRNA interactions are indirect and have high false-positive and negative rates. In this report, a genome-wide biochemical technique (high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation or HITS-CLIP) was used to generate unbiased genome-wide maps of miRNA-mRNA interactions in two critical cellular components of the marrow ME: marrow stromal cells and bone marrow endothelial cells. Analysis of these datasets identified miRNAs as direct regulators of JAG1, WNT5A, MMP2, and VEGFA; four factors that are important to ME function. Our results show the feasibility and utility of unbiased genome-wide biochemical techniques in dissecting the role of miRNAs in regulation of complex tissues such as the marrow ME.
LinkOut: [PMID: 24038734]
87 hsa-miR-452-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT150000 MIDN midnolin 2 10
MIRT330600 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT358701 SUB1 SUB1 homolog, transcriptional regulator 2 4
MIRT362854 EIF4H eukaryotic translation initiation factor 4H 2 2
MIRT447215 ATXN7 ataxin 7 2 2
MIRT466655 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 6
MIRT483979 PANK1 pantothenate kinase 1 2 8
MIRT485118 SF3B3 splicing factor 3b subunit 3 2 2
MIRT488864 AUTS8 Autism, susceptibility to, 8 2 2
MIRT492293 SH2B3 SH2B adaptor protein 3 2 2
MIRT492976 NCK2 NCK adaptor protein 2 2 2
MIRT497410 LRRC40 leucine rich repeat containing 40 2 2
MIRT511143 MRPL17 mitochondrial ribosomal protein L17 2 6
MIRT512650 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT513017 NSFL1C NSFL1 cofactor 2 6
MIRT520445 TSPAN2 tetraspanin 2 2 6
MIRT527995 NDNF neuron derived neurotrophic factor 2 2
MIRT528667 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT533512 TRIM71 tripartite motif containing 71 2 2
MIRT537404 FBXO47 F-box protein 47 2 2
MIRT538161 DCP2 decapping mRNA 2 2 2
MIRT539124 ARHGEF17 Rho guanine nucleotide exchange factor 17 2 2
MIRT540666 MIS18A MIS18 kinetochore protein A 2 4
MIRT542948 GDF11 growth differentiation factor 11 2 2
MIRT547534 MAML3 mastermind like transcriptional coactivator 3 2 2
MIRT559033 C20orf24 chromosome 20 open reading frame 24 2 4
MIRT559554 ARF6 ADP ribosylation factor 6 2 2
MIRT570177 RCBTB1 RCC1 and BTB domain containing protein 1 2 2
MIRT573149 ITGA9 integrin subunit alpha 9 2 2
MIRT575849 Rab1 RAB1A, member RAS oncogene family 1 1
MIRT611034 RRP1B ribosomal RNA processing 1B 2 2
MIRT616281 HMGB1 high mobility group box 1 2 2
MIRT618372 PRKG2 protein kinase, cGMP-dependent, type II 2 2
MIRT619540 PIWIL2 piwi like RNA-mediated gene silencing 2 2 2
MIRT622303 SGIP1 SH3 domain GRB2 like endophilin interacting protein 1 2 2
MIRT622590 PRRG4 proline rich and Gla domain 4 2 2
MIRT624441 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 2
MIRT637089 KLRD1 killer cell lectin like receptor D1 2 2
MIRT639084 ADCYAP1 adenylate cyclase activating polypeptide 1 2 2
MIRT639334 NINJ1 ninjurin 1 2 2
MIRT639798 EIF3E eukaryotic translation initiation factor 3 subunit E 2 2
MIRT640851 RAB3B RAB3B, member RAS oncogene family 2 2
MIRT641628 KIAA1244 ARFGEF family member 3 1 1
MIRT642634 EPPIN epididymal peptidase inhibitor 2 2
MIRT643053 EPPIN-WFDC6 EPPIN-WFDC6 readthrough 2 2
MIRT643416 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT645586 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT647393 FAM181B family with sequence similarity 181 member B 2 2
MIRT649411 CDC14B cell division cycle 14B 2 2
MIRT649477 CLDN16 claudin 16 2 2
MIRT651307 ZDHHC20 zinc finger DHHC-type containing 20 2 2
MIRT651387 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT653411 SLC7A2 solute carrier family 7 member 2 2 2
MIRT654084 RSPH4A radial spoke head 4 homolog A 2 2
MIRT654613 PTPRM protein tyrosine phosphatase, receptor type M 2 2
MIRT655338 PCP4L1 Purkinje cell protein 4 like 1 2 2
MIRT656173 MRPL44 mitochondrial ribosomal protein L44 2 2
MIRT657272 HS3ST3B1 heparan sulfate-glucosamine 3-sulfotransferase 3B1 2 2
MIRT657881 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT659875 CAPRIN1 cell cycle associated protein 1 2 2
MIRT662381 ICA1L islet cell autoantigen 1 like 2 4
MIRT666308 SLC22A3 solute carrier family 22 member 3 2 2
MIRT667274 NAV1 neuron navigator 1 2 2
MIRT667614 LIMCH1 LIM and calponin homology domains 1 2 2
MIRT674242 NUP62 nucleoporin 62 2 4
MIRT690386 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT693402 NUDT16 nudix hydrolase 16 2 2
MIRT702503 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT708632 STMN4 stathmin 4 2 2
MIRT708839 SCAND3 zinc finger BED-type containing 9 1 1
MIRT709016 HSBP1 heat shock factor binding protein 1 2 2
MIRT709235 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT710885 PARL presenilin associated rhomboid like 2 2
MIRT712262 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT712573 ATP2B4 ATPase plasma membrane Ca2+ transporting 4 2 2
MIRT715046 PRPF38A pre-mRNA processing factor 38A 2 2
MIRT718905 GALR1 galanin receptor 1 2 2
MIRT719368 FEM1A fem-1 homolog A 2 2
MIRT719495 SEC24B SEC24 homolog B, COPII coat complex component 2 2
MIRT719601 PRKX protein kinase, X-linked 2 2
MIRT719891 RRP36 ribosomal RNA processing 36 2 2
MIRT720063 ZNF449 zinc finger protein 449 2 2
MIRT721679 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT721724 VTI1A vesicle transport through interaction with t-SNAREs 1A 2 2
MIRT723370 ZNF470 zinc finger protein 470 2 2
MIRT724941 TXNL1 thioredoxin like 1 2 2
MIRT725302 NLRC5 NLR family CARD domain containing 5 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-452 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-452 Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-452 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 down-regulated
miR-452 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-mir-452 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-452-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-452-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-452-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-452-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (HCT8)
hsa-miR-452-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-452-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-452-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-452-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-452-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-452-3p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission