pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4464 |
Genomic Coordinates | chr6: 90312742 - 90312833 |
Description | Homo sapiens miR-4464 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4464 | |||||||||||||||||||||||||||||||||||
Sequence | 12| AAGGUUUGGAUAGAUGCAAUA |32 | |||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Hmox1 | ||||||||||||||||||||
Synonyms | D8Wsu38e, HO-1, HO1, Hemox, Hmox, Hsp32 | ||||||||||||||||||||
Description | heme oxygenase 1 | ||||||||||||||||||||
Transcript | NM_010442 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Hmox1 | |||||||||||||||||||||
3'UTR of Hmox1 (miRNA target sites are highlighted) |
>Hmox1|NM_010442|3'UTR 1 ATGCAATACTGGCCCCCAGGGGCTGTGAACTCTGTCCAATGTGGCCTTCTCTCTGTAAGGGAGAATCTTGCCTGGCTCTC 81 TTCTCTTGGGCCTCTAAGAAAGCTTTTGGGGTCCCTAGCCCACTCCCTGTGTTTCCTTTCTCTCTGGAATGGAGGGAGAT 161 ACCTGACACAGTTCCCTCACCAAAAGCACATCCAGCCAGTGGCCTGAACTTTGAAACCAGCAGCCCCAAATCCTGCAGCA 241 GAGCCCCAAAACTGGCCTGTAAAAGCAGCTGTTCTGAGCCCAGTGCCCATGGTTGTAAGCATCCATGTTGACTGACCACG 321 ACTGCTGTCCCCCAGTGCCATGGCCACTTTGATATCCGTTTCCAGACATTTCTGTCTCGTATTTCTGTCTTGTTTTTTAT 401 TATTTCCCCAGTTCTACCAGAGTAATGGTATTTTGTTGTTTTGTTTTGTCTTGTTTTTCCTAACAAAGTGGGGCTATCTT 481 TTGAGGGGTGGGTGGGAAAGAATTATTTAATAGTTGTAACCTTGGTCTCTAACTTCTGTGTGAAATAATAAATGGCATTA 561 TCTAACAGTCACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | hMSC |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP聽 data was present in GSM1013110. RNA binding protein: AGO. Condition:hMSC-replicate-1
... - Balakrishnan I; Yang X; Brown J; et al., 2014, Stem cells (Dayton, Ohio). |
Article |
- Balakrishnan I; Yang X; Brown J; et al. - Stem cells (Dayton, Ohio), 2014
Regulation of hematopoietic stem cell proliferation, lineage commitment, and differentiation in adult vertebrates requires extrinsic signals provided by cells in the marrow microenvironment (ME) located within the bone marrow. Both secreted and cell-surface bound factors critical to this regulation have been identified, yet control of their expression by cells within the ME has not been addressed. Herein we hypothesize that microRNAs (miRNAs) contribute to their controlled expression. MiRNAs are small noncoding RNAs that bind to target mRNAs and downregulate gene expression by either initiating mRNA degradation or preventing peptide translation. Testing the role of miRNAs in downregulating gene expression has been difficult since conventional techniques used to define miRNA-mRNA interactions are indirect and have high false-positive and negative rates. In this report, a genome-wide biochemical technique (high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation or HITS-CLIP) was used to generate unbiased genome-wide maps of miRNA-mRNA interactions in two critical cellular components of the marrow ME: marrow stromal cells and bone marrow endothelial cells. Analysis of these datasets identified miRNAs as direct regulators of JAG1, WNT5A, MMP2, and VEGFA; four factors that are important to ME function. Our results show the feasibility and utility of unbiased genome-wide biochemical techniques in dissecting the role of miRNAs in regulation of complex tissues such as the marrow ME.
LinkOut: [PMID: 24038734]
|
CLIP-seq Support 1 for dataset GSM1013110 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | hMSC / hMSC-replicate-1 |
Location of target site | ENST00000216117.8 | 3UTR | AGGGAUCAGCCCUGCCCUUCAGCAUCCUCAGUUCCUGCAGCAGAGCCUGGAAGACACCCUAAUGUGGCAGCUGUCUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24038734 / GSE41272 |
CLIP-seq Viewer | Link |
81 hsa-miR-4464 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT056004 | ARL5B | ADP ribosylation factor like GTPase 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT061568 | BTG2 | BTG anti-proliferation factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT078651 | ICT1 | mitochondrial ribosomal protein L58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT087551 | YWHAH | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta | ![]() |
![]() |
2 | 4 | ||||||
MIRT088139 | SEPT2 | septin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT095089 | SEC24A | SEC24 homolog A, COPII coat complex component | ![]() |
![]() |
2 | 4 | ||||||
MIRT099065 | FOXC1 | forkhead box C1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT150194 | MIDN | midnolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT178173 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT178942 | C11ORF57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 2 | ||||||
MIRT188776 | SESN2 | sestrin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT267026 | EFHD2 | EF-hand domain family member D2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT307213 | ACVR2B | activin A receptor type 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT324750 | ACER2 | alkaline ceramidase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442732 | TEAD1 | TEA domain transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444087 | C12orf73 | chromosome 12 open reading frame 73 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445527 | KLF9 | Kruppel like factor 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449604 | INIP | INTS3 and NABP interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT451129 | ZNF99 | zinc finger protein 99 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452271 | RPL30 | ribosomal protein L30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452486 | DDX4 | DEAD-box helicase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454868 | DNAJC15 | DnaJ heat shock protein family (Hsp40) member C15 | ![]() |
![]() |
2 | 6 | ||||||
MIRT455773 | TSPAN6 | tetraspanin 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT463844 | WRN | Werner syndrome RecQ like helicase | ![]() |
![]() |
2 | 2 | ||||||
MIRT465036 | TTC39C | tetratricopeptide repeat domain 39C | ![]() |
![]() |
2 | 2 | ||||||
MIRT465176 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT465294 | TRIB3 | tribbles pseudokinase 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT467931 | SLC16A7 | solute carrier family 16 member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471906 | NUAK2 | NUAK family kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472724 | MTUS1 | microtubule associated scaffold protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT479785 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482446 | ADM | adrenomedullin | ![]() |
![]() |
2 | 10 | ||||||
MIRT485365 | MYLIP | myosin regulatory light chain interacting protein | ![]() |
![]() |
2 | 12 | ||||||
MIRT498399 | KIF6 | kinesin family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT503202 | ACTB | actin beta | ![]() |
![]() |
2 | 6 | ||||||
MIRT503819 | TMEM242 | transmembrane protein 242 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504706 | ZNF117 | zinc finger protein 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT507802 | CDKN1B | cyclin dependent kinase inhibitor 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT509968 | KANSL1L | KAT8 regulatory NSL complex subunit 1 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT517306 | ELF4 | E74 like ETS transcription factor 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT523900 | ENPP6 | ectonucleotide pyrophosphatase/phosphodiesterase 6 | ![]() |
![]() |
2 | 6 | ||||||
MIRT532018 | NOX5 | NADPH oxidase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535334 | PHACTR2 | phosphatase and actin regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536944 | HCN4 | hyperpolarization activated cyclic nucleotide gated potassium channel 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT539322 | AHSA2 | activator of HSP90 ATPase homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540189 | GSTM4 | glutathione S-transferase mu 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545015 | ZNF439 | zinc finger protein 439 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545265 | TRIM36 | tripartite motif containing 36 | ![]() |
![]() |
2 | 4 | ||||||
MIRT547230 | PAG1 | phosphoprotein membrane anchor with glycosphingolipid microdomains 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548425 | ELOVL5 | ELOVL fatty acid elongase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549910 | ADH4 | alcohol dehydrogenase 4 (class II), pi polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT550185 | TMEM106C | transmembrane protein 106C | ![]() |
![]() |
2 | 2 | ||||||
MIRT550775 | ENOX2 | ecto-NOX disulfide-thiol exchanger 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT552401 | ZNF487P | zinc finger protein 487 | ![]() |
1 | 1 | |||||||
MIRT554782 | RHEBP1 | RHEB pseudogene 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT557311 | HIF1A | hypoxia inducible factor 1 alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT558635 | CNNM2 | cyclin and CBS domain divalent metal cation transport mediator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563168 | RPS14 | ribosomal protein S14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564886 | YWHAE | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon | ![]() |
![]() |
2 | 2 | ||||||
MIRT565778 | SEPHS1 | selenophosphate synthetase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566480 | PDCD4 | programmed cell death 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567206 | IGFBP5 | insulin like growth factor binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568931 | SMCR8 | Smith-Magenis syndrome chromosome region, candidate 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570698 | FBXO41 | F-box protein 41 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573474 | MTRNR2L9 | MT-RNR2-like 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT576170 | Hmox1 | heme oxygenase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607555 | GLI2 | GLI family zinc finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608203 | ERBB2 | erb-b2 receptor tyrosine kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609779 | VWC2L | von Willebrand factor C domain containing protein 2 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT616312 | CELF2 | CUGBP Elav-like family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617190 | CDH13 | cadherin 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626842 | RPLP1 | ribosomal protein lateral stalk subunit P1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636438 | MARCH1 | membrane associated ring-CH-type finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639101 | GLIPR1L2 | GLI pathogenesis related 1 like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691018 | CRTC3 | CREB regulated transcription coactivator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700008 | RPS21 | ribosomal protein S21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701144 | PANK1 | pantothenate kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712691 | NUDT7 | nudix hydrolase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715505 | MAZ | MYC associated zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT722509 | PTPRC | protein tyrosine phosphatase, receptor type C | ![]() |
![]() |
2 | 2 | ||||||
MIRT724982 | TNS1 | tensin 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | |||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|