pre-miRNA Information
pre-miRNA hsa-mir-4464   
Genomic Coordinates chr6: 90312742 - 90312833
Description Homo sapiens miR-4464 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4464
Sequence 12| AAGGUUUGGAUAGAUGCAAUA |32
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 6 + 90312764 29233923 MiREDiBase
A-to-I 14 6 + 90312766 29233923 MiREDiBase
A-to-I 19 6 + 90312771 29233923 MiREDiBase
A-to-I 21 6 + 90312773 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1240632245 2 dbSNP
rs34899210 2 dbSNP
rs1003034046 13 dbSNP
rs1475351324 14 dbSNP
rs1257582329 17 dbSNP
rs1193587810 20 dbSNP
Putative Targets

Gene Information
Gene Symbol Hmox1   
Synonyms D8Wsu38e, HO-1, HO1, Hemox, Hmox, Hsp32
Description heme oxygenase 1
Transcript NM_010442   
Expression
Putative miRNA Targets on Hmox1
3'UTR of Hmox1
(miRNA target sites are highlighted)
>Hmox1|NM_010442|3'UTR
   1 ATGCAATACTGGCCCCCAGGGGCTGTGAACTCTGTCCAATGTGGCCTTCTCTCTGTAAGGGAGAATCTTGCCTGGCTCTC
  81 TTCTCTTGGGCCTCTAAGAAAGCTTTTGGGGTCCCTAGCCCACTCCCTGTGTTTCCTTTCTCTCTGGAATGGAGGGAGAT
 161 ACCTGACACAGTTCCCTCACCAAAAGCACATCCAGCCAGTGGCCTGAACTTTGAAACCAGCAGCCCCAAATCCTGCAGCA
 241 GAGCCCCAAAACTGGCCTGTAAAAGCAGCTGTTCTGAGCCCAGTGCCCATGGTTGTAAGCATCCATGTTGACTGACCACG
 321 ACTGCTGTCCCCCAGTGCCATGGCCACTTTGATATCCGTTTCCAGACATTTCTGTCTCGTATTTCTGTCTTGTTTTTTAT
 401 TATTTCCCCAGTTCTACCAGAGTAATGGTATTTTGTTGTTTTGTTTTGTCTTGTTTTTCCTAACAAAGTGGGGCTATCTT
 481 TTGAGGGGTGGGTGGGAAAGAATTATTTAATAGTTGTAACCTTGGTCTCTAACTTCTGTGTGAAATAATAAATGGCATTA
 561 TCTAACAGTCACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' auaACGUAGAU---AGGUUUGGAa 5'
             |||| | :    ||||| || 
Target 5' tccTGCAGCAGAGCCCCAAAACTg 3'
231 - 254 118.00 -6.60
2
miRNA  3' auAAC-GUAG--AUAGGUUUGGAa 5'
            ||| :|||  | ||||:|| | 
Target 5' ctTTGATATCCGTTTCCAGACATt 3'
347 - 370 117.00 -9.52
3
miRNA  3' auAACGU---AGAUAG-GUUUGGAa 5'
            |||:|   |: :|| | |||:| 
Target 5' agTTGTAACCTTGGTCTCTAACTTc 3'
512 - 536 107.00 -5.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hMSC
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP聽 data was present in GSM1013110. RNA binding protein: AGO. Condition:hMSC-replicate-1 ...

- Balakrishnan I; Yang X; Brown J; et al., 2014, Stem cells (Dayton, Ohio).

Article - Balakrishnan I; Yang X; Brown J; et al.
- Stem cells (Dayton, Ohio), 2014
Regulation of hematopoietic stem cell proliferation, lineage commitment, and differentiation in adult vertebrates requires extrinsic signals provided by cells in the marrow microenvironment (ME) located within the bone marrow. Both secreted and cell-surface bound factors critical to this regulation have been identified, yet control of their expression by cells within the ME has not been addressed. Herein we hypothesize that microRNAs (miRNAs) contribute to their controlled expression. MiRNAs are small noncoding RNAs that bind to target mRNAs and downregulate gene expression by either initiating mRNA degradation or preventing peptide translation. Testing the role of miRNAs in downregulating gene expression has been difficult since conventional techniques used to define miRNA-mRNA interactions are indirect and have high false-positive and negative rates. In this report, a genome-wide biochemical technique (high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation or HITS-CLIP) was used to generate unbiased genome-wide maps of miRNA-mRNA interactions in two critical cellular components of the marrow ME: marrow stromal cells and bone marrow endothelial cells. Analysis of these datasets identified miRNAs as direct regulators of JAG1, WNT5A, MMP2, and VEGFA; four factors that are important to ME function. Our results show the feasibility and utility of unbiased genome-wide biochemical techniques in dissecting the role of miRNAs in regulation of complex tissues such as the marrow ME.
LinkOut: [PMID: 24038734]
CLIP-seq Support 1 for dataset GSM1013110
Method / RBP HITS-CLIP  / AGO
Cell line / Condition hMSC / hMSC-replicate-1
Location of target site ENST00000216117.8 | 3UTR | AGGGAUCAGCCCUGCCCUUCAGCAUCCUCAGUUCCUGCAGCAGAGCCUGGAAGACACCCUAAUGUGGCAGCUGUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24038734 / GSE41272
CLIP-seq Viewer Link
81 hsa-miR-4464 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT056004 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT061568 BTG2 BTG anti-proliferation factor 2 2 2
MIRT078651 ICT1 mitochondrial ribosomal protein L58 2 2
MIRT087551 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 4
MIRT088139 SEPT2 septin 2 2 4
MIRT095089 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT099065 FOXC1 forkhead box C1 2 4
MIRT150194 MIDN midnolin 2 2
MIRT178173 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 4
MIRT178942 C11ORF57 chromosome 11 open reading frame 57 2 2
MIRT188776 SESN2 sestrin 2 2 2
MIRT267026 EFHD2 EF-hand domain family member D2 2 2
MIRT307213 ACVR2B activin A receptor type 2B 2 2
MIRT324750 ACER2 alkaline ceramidase 2 2 2
MIRT442732 TEAD1 TEA domain transcription factor 1 2 2
MIRT444087 C12orf73 chromosome 12 open reading frame 73 2 2
MIRT445527 KLF9 Kruppel like factor 9 2 2
MIRT449604 INIP INTS3 and NABP interacting protein 2 2
MIRT451129 ZNF99 zinc finger protein 99 2 2
MIRT452271 RPL30 ribosomal protein L30 2 2
MIRT452486 DDX4 DEAD-box helicase 4 2 2
MIRT454868 DNAJC15 DnaJ heat shock protein family (Hsp40) member C15 2 6
MIRT455773 TSPAN6 tetraspanin 6 2 4
MIRT463844 WRN Werner syndrome RecQ like helicase 2 2
MIRT465036 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT465176 TRPV2 transient receptor potential cation channel subfamily V member 2 2 4
MIRT465294 TRIB3 tribbles pseudokinase 3 2 4
MIRT467931 SLC16A7 solute carrier family 16 member 7 2 2
MIRT471906 NUAK2 NUAK family kinase 2 2 2
MIRT472724 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT479785 CCND1 cyclin D1 2 2
MIRT482446 ADM adrenomedullin 2 10
MIRT485365 MYLIP myosin regulatory light chain interacting protein 2 12
MIRT498399 KIF6 kinesin family member 6 2 2
MIRT503202 ACTB actin beta 2 6
MIRT503819 TMEM242 transmembrane protein 242 2 2
MIRT504706 ZNF117 zinc finger protein 117 2 2
MIRT507802 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT509968 KANSL1L KAT8 regulatory NSL complex subunit 1 like 2 4
MIRT517306 ELF4 E74 like ETS transcription factor 4 2 6
MIRT523900 ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6 2 6
MIRT532018 NOX5 NADPH oxidase 5 2 2
MIRT535334 PHACTR2 phosphatase and actin regulator 2 2 2
MIRT536944 HCN4 hyperpolarization activated cyclic nucleotide gated potassium channel 4 2 4
MIRT539322 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT540189 GSTM4 glutathione S-transferase mu 4 2 2
MIRT545015 ZNF439 zinc finger protein 439 2 2
MIRT545265 TRIM36 tripartite motif containing 36 2 4
MIRT547230 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT548425 ELOVL5 ELOVL fatty acid elongase 5 2 2
MIRT549910 ADH4 alcohol dehydrogenase 4 (class II), pi polypeptide 2 2
MIRT550185 TMEM106C transmembrane protein 106C 2 2
MIRT550775 ENOX2 ecto-NOX disulfide-thiol exchanger 2 2 4
MIRT552401 ZNF487P zinc finger protein 487 1 1
MIRT554782 RHEBP1 RHEB pseudogene 1 2 4
MIRT557311 HIF1A hypoxia inducible factor 1 alpha subunit 2 2
MIRT558635 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT563168 RPS14 ribosomal protein S14 2 2
MIRT564886 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 2
MIRT565778 SEPHS1 selenophosphate synthetase 1 2 2
MIRT566480 PDCD4 programmed cell death 4 2 2
MIRT567206 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT568931 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT570698 FBXO41 F-box protein 41 2 2
MIRT573474 MTRNR2L9 MT-RNR2-like 9 2 2
MIRT576170 Hmox1 heme oxygenase 1 2 2
MIRT607555 GLI2 GLI family zinc finger 2 2 2
MIRT608203 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT609779 VWC2L von Willebrand factor C domain containing protein 2 like 2 4
MIRT616312 CELF2 CUGBP Elav-like family member 2 2 2
MIRT617190 CDH13 cadherin 13 2 2
MIRT626842 RPLP1 ribosomal protein lateral stalk subunit P1 2 2
MIRT636438 MARCH1 membrane associated ring-CH-type finger 1 2 2
MIRT639101 GLIPR1L2 GLI pathogenesis related 1 like 2 2 2
MIRT691018 CRTC3 CREB regulated transcription coactivator 3 2 2
MIRT700008 RPS21 ribosomal protein S21 2 2
MIRT701144 PANK1 pantothenate kinase 1 2 2
MIRT712691 NUDT7 nudix hydrolase 7 2 2
MIRT715505 MAZ MYC associated zinc finger protein 2 2
MIRT722509 PTPRC protein tyrosine phosphatase, receptor type C 2 2
MIRT724982 TNS1 tensin 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miR-4464 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4464 Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)

Error report submission