miRTarBase - #MIRT576640


—
pre-miRNA Information
pre-miRNA hsa-mir-4656   
Genomic Coordinates chr7: 4788565 - 4788639
Description Homo sapiens miR-4656 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4656
Sequence 10| UGGGCUGAGGGCAGGAGGCCUGU |32
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1257485407 2 dbSNP
rs71535143 5 dbSNP
rs933178228 7 dbSNP
rs895666746 9 dbSNP
rs1053330554 11 dbSNP
rs1327822621 13 dbSNP
rs934599733 16 dbSNP
rs1260841927 19 dbSNP
rs1371177672 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Gene Information
Gene Symbol Mill2   
Synonyms Micb
Description MHC I like leukocyte 2
Transcript NM_153760   
Other Transcripts NM_153761   
Expression
Putative miRNA Targets on Mill2
3'UTR of Mill2
(miRNA target sites are highlighted)		 
>Mill2|NM_153760|3'UTR
   1 ATCCAGAACACAAAGGACAGGACCAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uguccggaggacgggaGUCgggu 5'
                          |||    
Target 5' -------------atcCAGaaca 3'
 1 - 10 60.00 -8.00
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HS5
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP聽 data was present in GSM1013105. RNA binding protein: AGO. Condition:HS5-replicate-2 ...

- Balakrishnan I; Yang X; Brown J; et al., 2014, Stem cells (Dayton, Ohio).

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uguccggaggacgggaGUCGGGu 5'
                          |||||| 
Target 5' -----------uugacCAGCCCa 3'
 		1 - 12
2 
miRNA  3' uguccgGAGGACGGGAGUCGGgu 5'
                |||||| |||||| :  
Target 5' uucaaaCUCCUGACCUCAGGUga 3'
 		15 - 37
Article - Balakrishnan I; Yang X; Brown J; et al.
- Stem cells (Dayton, Ohio), 2014
Regulation of hematopoietic stem cell proliferation, lineage commitment, and differentiation in adult vertebrates requires extrinsic signals provided by cells in the marrow microenvironment (ME) located within the bone marrow. Both secreted and cell-surface bound factors critical to this regulation have been identified, yet control of their expression by cells within the ME has not been addressed. Herein we hypothesize that microRNAs (miRNAs) contribute to their controlled expression. MiRNAs are small noncoding RNAs that bind to target mRNAs and downregulate gene expression by either initiating mRNA degradation or preventing peptide translation. Testing the role of miRNAs in downregulating gene expression has been difficult since conventional techniques used to define miRNA-mRNA interactions are indirect and have high false-positive and negative rates. In this report, a genome-wide biochemical technique (high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation or HITS-CLIP) was used to generate unbiased genome-wide maps of miRNA-mRNA interactions in two critical cellular components of the marrow ME: marrow stromal cells and bone marrow endothelial cells. Analysis of these datasets identified miRNAs as direct regulators of JAG1, WNT5A, MMP2, and VEGFA; four factors that are important to ME function. Our results show the feasibility and utility of unbiased genome-wide biochemical techniques in dissecting the role of miRNAs in regulation of complex tissues such as the marrow ME.
LinkOut: [PMID: 24038734]
48 hsa-miR-4656 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT135536 RAB5B RAB5B, member RAS oncogene family 2 2
MIRT168127 SOX4 SRY-box 4 2 2
MIRT301229 SH3BP4 SH3 domain binding protein 4 2 2
MIRT444362 TIMM8B translocase of inner mitochondrial membrane 8 homolog B 2 2
MIRT445909 SLC10A3 solute carrier family 10 member 3 2 2
MIRT447283 LAPTM5 lysosomal protein transmembrane 5 2 2
MIRT453797 KBTBD12 kelch repeat and BTB domain containing 12 2 2
MIRT456777 MTHFSD methenyltetrahydrofolate synthetase domain containing 2 2
MIRT459647 PCSK9 proprotein convertase subtilisin/kexin type 9 2 2
MIRT462333 BCL7B BCL tumor suppressor 7B 2 2
MIRT463535 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT465799 TMEM91 transmembrane protein 91 2 2
MIRT470647 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT470837 PLXND1 plexin D1 2 2
MIRT471129 PHF19 PHD finger protein 19 2 2
MIRT483310 SLC35C2 solute carrier family 35 member C2 2 2
MIRT487264 CCNF cyclin F 2 2
MIRT491731 SEMA3F semaphorin 3F 2 2
MIRT497195 DRP2 dystrophin related protein 2 2 2
MIRT508384 SPTBN2 spectrin beta, non-erythrocytic 2 2 4
MIRT530496 FADS6 fatty acid desaturase 6 2 2
MIRT546995 PPP2CA protein phosphatase 2 catalytic subunit alpha 2 2
MIRT549790 KIAA0391 KIAA0391 2 2
MIRT560368 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT566000 RNF4 ring finger protein 4 2 2
MIRT574035 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT574231 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT576139 Hmox1 heme oxygenase 1 2 2
MIRT576640 Mill2 MHC I like leukocyte 2 1 1
MIRT609875 RAD54L2 RAD54 like 2 2 4
MIRT622651 POU2F3 POU class 2 homeobox 3 2 4
MIRT628848 FAM151B family with sequence similarity 151 member B 2 2
MIRT634252 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT634672 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT649087 FBXO25 F-box protein 25 2 2
MIRT665019 ELK1 ELK1, ETS transcription factor 2 2
MIRT666939 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT668960 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT675802 MED28 mediator complex subunit 28 2 2
MIRT684022 FOLR1 folate receptor 1 2 2
MIRT696480 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT705894 ADCY9 adenylate cyclase 9 2 2
MIRT709434 ZSCAN25 zinc finger and SCAN domain containing 25 2 2
MIRT713572 SLC2A8 solute carrier family 2 member 8 2 2
MIRT716697 HLA-B major histocompatibility complex, class I, B 2 2
MIRT719735 SLC39A11 solute carrier family 39 member 11 2 2
MIRT724907 DAO D-amino acid oxidase 2 2
MIRT725321 NFASC neurofascin 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4656 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4656 Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-mir-4656 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4656 Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-4656 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-4656 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-4656 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4656 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4656 Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-4656 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)

Error report submission