miRTarBase - #MIRT576643


—
pre-miRNA Information
pre-miRNA hsa-mir-378g   
Genomic Coordinates chr1: 94745860 - 94745900
Description Homo sapiens miR-378g stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-378g
Sequence 2| ACUGGGCUUGGAGUCAGAAG |21
Evidence Experimental
Experiments Illumina
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Gene Information
Gene Symbol Mill2   
Synonyms Micb
Description MHC I like leukocyte 2
Transcript NM_153760   
Other Transcripts NM_153761   
Expression
Putative miRNA Targets on Mill2
3'UTR of Mill2
(miRNA target sites are highlighted)		 
>Mill2|NM_153760|3'UTR
   1 ATCCAGAACACAAAGGACAGGACCAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaagacugagGUUCGGGUCa 5'
                    ||:| |||| 
Target 5' acacaaaggaCAGGACCAG- 3'
 8 - 26 102.00 -9.50
2 
miRNA  3' gaagacugagguucGGGUca 5'
                        :|||  
Target 5' -------------aTCCAga 3'
 1 - 7 64.00 -5.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HS5
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP聽 data was present in GSM1013105. RNA binding protein: AGO. Condition:HS5-replicate-2 ...

- Balakrishnan I; Yang X; Brown J; et al., 2014, Stem cells (Dayton, Ohio).

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaaGACUGAGGUUCGGGUCa 5'
             :|||  || ||||||| 
Target 5' ---UUGA--CC-AGCCCAGu 3'
 		1 - 14
2 
miRNA  3' gaAGACUGAGG-UUCGGGUCA 5'
            ||  ||||| :| |:||| 
Target 5' uuUCAAACUCCUGACCUCAGG 3'
 		14 - 34
Article - Balakrishnan I; Yang X; Brown J; et al.
- Stem cells (Dayton, Ohio), 2014
Regulation of hematopoietic stem cell proliferation, lineage commitment, and differentiation in adult vertebrates requires extrinsic signals provided by cells in the marrow microenvironment (ME) located within the bone marrow. Both secreted and cell-surface bound factors critical to this regulation have been identified, yet control of their expression by cells within the ME has not been addressed. Herein we hypothesize that microRNAs (miRNAs) contribute to their controlled expression. MiRNAs are small noncoding RNAs that bind to target mRNAs and downregulate gene expression by either initiating mRNA degradation or preventing peptide translation. Testing the role of miRNAs in downregulating gene expression has been difficult since conventional techniques used to define miRNA-mRNA interactions are indirect and have high false-positive and negative rates. In this report, a genome-wide biochemical technique (high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation or HITS-CLIP) was used to generate unbiased genome-wide maps of miRNA-mRNA interactions in two critical cellular components of the marrow ME: marrow stromal cells and bone marrow endothelial cells. Analysis of these datasets identified miRNAs as direct regulators of JAG1, WNT5A, MMP2, and VEGFA; four factors that are important to ME function. Our results show the feasibility and utility of unbiased genome-wide biochemical techniques in dissecting the role of miRNAs in regulation of complex tissues such as the marrow ME.
LinkOut: [PMID: 24038734]
68 hsa-miR-378g Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT444739 SMYD1 SET and MYND domain containing 1 2 2
MIRT456104 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT458683 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT465802 TMEM91 transmembrane protein 91 2 2
MIRT470843 PLXND1 plexin D1 2 2
MIRT497263 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT497674 SYNGR1 synaptogyrin 1 2 2
MIRT498218 TLN2 talin 2 2 2
MIRT498309 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT504046 TOMM5 translocase of outer mitochondrial membrane 5 2 2
MIRT518196 CLEC4E C-type lectin domain family 4 member E 2 2
MIRT533143 WNT10A Wnt family member 10A 2 2
MIRT533540 TPR translocated promoter region, nuclear basket protein 2 2
MIRT533679 TMEM86A transmembrane protein 86A 2 2
MIRT540892 SRSF9 serine and arginine rich splicing factor 9 2 2
MIRT541329 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT541850 PLIN5 perilipin 5 2 2
MIRT551431 F2 coagulation factor II, thrombin 2 2
MIRT552105 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 2
MIRT564912 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT568605 ACVR2A activin A receptor type 2A 2 2
MIRT572604 PAPLN papilin, proteoglycan like sulfated glycoprotein 2 2
MIRT574234 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT575688 Map1b microtubule-associated protein 1B 2 2
MIRT576643 Mill2 MHC I like leukocyte 2 1 1
MIRT609877 RAD54L2 RAD54 like 2 2 4
MIRT610057 MYBPC1 myosin binding protein C, slow type 2 2
MIRT610791 KLK2 kallikrein related peptidase 2 2 2
MIRT617175 GOSR2 golgi SNAP receptor complex member 2 2 2
MIRT617707 RUSC2 RUN and SH3 domain containing 2 2 2
MIRT620577 WBSCR27 methyltransferase like 27 2 4
MIRT622657 POU2F3 POU class 2 homeobox 3 2 4
MIRT624561 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT634255 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT634677 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT635254 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT637081 SELPLG selectin P ligand 2 2
MIRT639021 AAK1 AP2 associated kinase 1 2 2
MIRT640396 ZNF785 zinc finger protein 785 2 2
MIRT642441 CLUAP1 clusterin associated protein 1 2 2
MIRT645666 ADK adenosine kinase 2 2
MIRT646083 MGST3 microsomal glutathione S-transferase 3 2 2
MIRT650513 UFM1 ubiquitin fold modifier 1 2 2
MIRT652474 TMEM181 transmembrane protein 181 2 2
MIRT652584 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654763 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 2
MIRT655200 PHAX phosphorylated adaptor for RNA export 2 2
MIRT658353 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT661820 PRPSAP1 phosphoribosyl pyrophosphate synthetase associated protein 1 2 2
MIRT662190 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT664375 CYB5A cytochrome b5 type A 2 2
MIRT665025 ELK1 ELK1, ETS transcription factor 2 2
MIRT666492 SBNO1 strawberry notch homolog 1 2 2
MIRT668480 EXOSC2 exosome component 2 2 2
MIRT682768 TMEM120B transmembrane protein 120B 2 2
MIRT689628 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT691846 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT696490 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT712480 FSTL3 follistatin like 3 2 2
MIRT712780 ZNF154 zinc finger protein 154 2 2
MIRT716607 MPPED1 metallophosphoesterase domain containing 1 2 2
MIRT719357 ITPKB inositol-trisphosphate 3-kinase B 2 2
MIRT719739 SLC39A11 solute carrier family 39 member 11 2 2
MIRT722569 C1orf95 stum, mechanosensory transduction mediator homolog 2 2
MIRT722838 C17orf102 chromosome 17 open reading frame 102 2 2
MIRT733138 LINC00963 long intergenic non-protein coding RNA 963 3 0
MIRT733139 CHI3L1 chitinase 3 like 1 3 0
MIRT736944 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-378g Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-378g Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-378g Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line
hsa-miR-378g Dabrafenib + Trametinib sensitive High Melanoma cell line
hsa-miR-378g Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line
hsa-mir-378g Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-378g Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-378g Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-378g Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-378g Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-378g Tripterygium wilfordii Hook F resistant tissue
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM36)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-378g Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-378g Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-378g Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission