pre-miRNA Information
pre-miRNA hsa-mir-548t   
Genomic Coordinates chr4: 173268160 - 173268233
Description Homo sapiens miR-548t stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548t-3p
Sequence 46| AAAAACCACAAUUACUUUUGCACCA |70
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 4 + 173268206 29233923 MiREDiBase
A-to-I 3 4 + 173268207 29233923 MiREDiBase
A-to-I 4 4 + 173268208 29233923 MiREDiBase
A-to-I 10 4 + 173268214 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs73872515 5 dbSNP
rs1426966747 6 dbSNP
rs1158401109 21 dbSNP
rs943938928 24 dbSNP
Putative Targets

Gene Information
Gene Symbol Slc30a3   
Synonyms Znt3
Description solute carrier family 30 (zinc transporter), member 3
Transcript NM_011773   
Expression
Putative miRNA Targets on Slc30a3
3'UTR of Slc30a3
(miRNA target sites are highlighted)
>Slc30a3|NM_011773|3'UTR
   1 GCCTCAGCCCCACCCTCACCCCACTGCCAGGCCCAGGCTCTCGCCTGGACTCTCAGCACCTGCCTCCCAGATCAGAAGGG
  81 ACCTCTCTCTCTCTCCATCTTCCACCTGCCAAAAGCCCTAGCCCATGCCCTGGTGGCCAAGACCAAAGTGTATATGAAGG
 161 CAATGGGGGGAGGGGAGGCTCAGATTGAATAGCTGTAAGCAGTTCAGGGCTGTGGGGCGTGTGGAAGCCCTGCCATCCAT
 241 GCTCCACATGGAGAGTCATGCTTGTCCCTCTACGATTCATGTGTCCCTGTGGCAGGCTGGCTGGCTAGCTGGGGACATCT
 321 GCCTGTCTGTGTGCTGTTTATGTGTGCCTGTGCCTGGGGAGGTCATCAGGGGCCCCCCTCCCCATGTGACCCTTGCTCTG
 401 TCTATGCAGCGGCCCCAAAGCCTGCACTTTGTTTGTGTGCCCTAGTCCTGTGGTTTTGTCTGTTGTGAATGTGTGTTCTT
 481 TGGTGCTGTGGCCTGTGTGTCCCTGTGCCTGTGTAGCTGTGCTGGTTTGTGAGTCTGCTCCACCTGTGTGTCCATATGGG
 561 ATCTGTCTGTCCATCCCTGTGTTGGTGCTGTGTCCTCAGCTTTCCCCAAGGGAGAGGGAGGACTCCACTGCAGCTCCACA
 641 AATAAAAACTTGGATCTAACTGTAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' acCACGUUUUCAUUAACACCAAAAa 5'
            ||||   |||   ||||||||| 
Target 5' gtGTGCCCTAGT-CCTGTGGTTTTg 3'
435 - 458 162.00 -14.90
2
miRNA  3' acCACGUUUUCAUUAAC---ACCAAAaa 5'
            ||||  : |||: ||   ||||||  
Target 5' ctGTGCCTGTGTAGCTGTGCTGGTTTgt 3'
503 - 530 143.00 -12.00
3
miRNA  3' accAC-GUUUUC---AUU---AAC---ACCAaaaa 5'
             || ||||||   ||:    ||   ||||    
Target 5' accTGCCAAAAGCCCTAGCCCATGCCCTGGTggcc 3'
104 - 138 94.00 -9.04
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HS5
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP聽 data was present in GSM1013105. RNA binding protein: AGO. Condition:HS5-replicate-2 ...

- Balakrishnan I; Yang X; Brown J; et al., 2014, Stem cells (Dayton, Ohio).

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acCACGUUUUCAUUAACAC-CAAAaa 5'
            |||:: : ||:  |||| || |  
Target 5' cuGUGUGUGUGUGUGUGUGUGUGUgu 3'
4 - 29
Article - Balakrishnan I; Yang X; Brown J; et al.
- Stem cells (Dayton, Ohio), 2014
Regulation of hematopoietic stem cell proliferation, lineage commitment, and differentiation in adult vertebrates requires extrinsic signals provided by cells in the marrow microenvironment (ME) located within the bone marrow. Both secreted and cell-surface bound factors critical to this regulation have been identified, yet control of their expression by cells within the ME has not been addressed. Herein we hypothesize that microRNAs (miRNAs) contribute to their controlled expression. MiRNAs are small noncoding RNAs that bind to target mRNAs and downregulate gene expression by either initiating mRNA degradation or preventing peptide translation. Testing the role of miRNAs in downregulating gene expression has been difficult since conventional techniques used to define miRNA-mRNA interactions are indirect and have high false-positive and negative rates. In this report, a genome-wide biochemical technique (high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation or HITS-CLIP) was used to generate unbiased genome-wide maps of miRNA-mRNA interactions in two critical cellular components of the marrow ME: marrow stromal cells and bone marrow endothelial cells. Analysis of these datasets identified miRNAs as direct regulators of JAG1, WNT5A, MMP2, and VEGFA; four factors that are important to ME function. Our results show the feasibility and utility of unbiased genome-wide biochemical techniques in dissecting the role of miRNAs in regulation of complex tissues such as the marrow ME.
LinkOut: [PMID: 24038734]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acCACGUUUUCAUUAACAC-CAAAaa 5'
            |||:: : ||:  |||| || |  
Target 5' cuGUGUGUGUGUGUGUGUGUGUGUgu 3'
4 - 29
Article - Spengler RM; Zhang X; Cheng C; McLendon JM; et al.
- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
CLIP-seq Support 1 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000233535.4 | 3UTR | UGUCUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000233535.4 | 3UTR | UGUCUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084047
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep4
Location of target site ENST00000233535.4 | 3UTR | UGUCUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000233535.4 | 3UTR | UUUUGUCUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084072
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_AbnovaAb
Location of target site ENST00000233535.4 | 3UTR | UGUCUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1013105
Method / RBP HITS-CLIP  / AGO
Cell line / Condition HS5 / HS5-replicate-2
Location of target site ENST00000233535.4 | 3UTR | UGUCUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24038734 / GSE41272
CLIP-seq Viewer Link
168 hsa-miR-548t-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059365 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT072839 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 6
MIRT076945 PCGF2 polycomb group ring finger 2 2 6
MIRT083941 TFAP2C transcription factor AP-2 gamma 2 2
MIRT085401 ETS2 ETS proto-oncogene 2, transcription factor 2 2
MIRT109790 KLHL15 kelch like family member 15 2 2
MIRT114046 AKAP11 A-kinase anchoring protein 11 2 10
MIRT130165 TXNIP thioredoxin interacting protein 2 6
MIRT150013 MIDN midnolin 2 2
MIRT181258 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT205594 NCL nucleolin 2 2
MIRT222253 ACTB actin beta 2 4
MIRT245653 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 4
MIRT250947 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 4
MIRT252497 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT271990 ARF1 ADP ribosylation factor 1 2 4
MIRT280804 RNF11 ring finger protein 11 2 2
MIRT293803 FEM1A fem-1 homolog A 2 2
MIRT318231 RREB1 ras responsive element binding protein 1 2 2
MIRT341455 ATP6V0B ATPase H+ transporting V0 subunit b 2 2
MIRT347413 CEBPG CCAAT/enhancer binding protein gamma 2 4
MIRT351860 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT357983 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT377094 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT407303 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT441564 LMOD3 leiomodin 3 2 2
MIRT442364 ZC3H12C zinc finger CCCH-type containing 12C 2 2
MIRT443228 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT443404 HMX3 H6 family homeobox 3 2 2
MIRT446055 NR5A2 nuclear receptor subfamily 5 group A member 2 2 2
MIRT448277 ZNF652 zinc finger protein 652 2 2
MIRT450822 KCNB1 potassium voltage-gated channel subfamily B member 1 2 2
MIRT453016 CCDC115 coiled-coil domain containing 115 2 17
MIRT454463 PPP2R2B protein phosphatase 2 regulatory subunit Bbeta 2 2
MIRT456360 CITED2 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 2 2
MIRT460007 DNALI1 dynein axonemal light intermediate chain 1 2 2
MIRT463154 ZNF385A zinc finger protein 385A 2 6
MIRT463766 YPEL2 yippee like 2 2 2
MIRT468310 SFT2D2 SFT2 domain containing 2 2 2
MIRT470668 POLR2D RNA polymerase II subunit D 2 4
MIRT478517 CTTN cortactin 2 2
MIRT480507 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT484718 INHBA inhibin beta A subunit 2 12
MIRT485494 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT487302 SLC38A9 solute carrier family 38 member 9 2 2
MIRT487771 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 16
MIRT491876 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT494304 CEP120 centrosomal protein 120 2 2
MIRT495396 TRIM24 tripartite motif containing 24 2 2
MIRT495646 CDK1 cyclin dependent kinase 1 2 2
MIRT496665 TMEM237 transmembrane protein 237 2 2
MIRT496837 ZNF460 zinc finger protein 460 2 2
MIRT498638 CHD4 chromodomain helicase DNA binding protein 4 2 10
MIRT503928 FBXL13 F-box and leucine rich repeat protein 13 2 4
MIRT506063 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT506582 MIER3 MIER family member 3 2 4
MIRT506606 MAT2A methionine adenosyltransferase 2A 2 4
MIRT506844 KIF23 kinesin family member 23 2 6
MIRT508536 RPP14 ribonuclease P/MRP subunit p14 2 4
MIRT509669 ZNF354B zinc finger protein 354B 2 10
MIRT511170 MBNL3 muscleblind like splicing regulator 3 2 6
MIRT512147 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT512831 ID4 inhibitor of DNA binding 4, HLH protein 2 6
MIRT514558 XRCC3 X-ray repair cross complementing 3 2 4
MIRT515856 AJAP1 adherens junctions associated protein 1 2 4
MIRT521848 PNISR PNN interacting serine and arginine rich protein 2 4
MIRT525364 SYNM synemin 2 2
MIRT527120 ARHGAP15 Rho GTPase activating protein 15 2 2
MIRT527271 FBLN2 fibulin 2 2 2
MIRT527439 COL4A3 collagen type IV alpha 3 chain 2 2
MIRT527658 CD300E CD300e molecule 2 2
MIRT528334 TBC1D22B TBC1 domain family member 22B 2 2
MIRT529033 EXOC8 exocyst complex component 8 2 2
MIRT529321 PDE5A phosphodiesterase 5A 2 2
MIRT529677 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT529846 SMTN smoothelin 2 2
MIRT530385 ZNF431 zinc finger protein 431 2 2
MIRT530913 GPR85 G protein-coupled receptor 85 2 2
MIRT531794 KDR kinase insert domain receptor 2 2
MIRT532246 KLF2 Kruppel like factor 2 2 4
MIRT532658 CBX7 chromobox 7 2 2
MIRT533630 TMX3 thioredoxin related transmembrane protein 3 2 2
MIRT534811 RAB33B RAB33B, member RAS oncogene family 2 2
MIRT534975 PSD3 pleckstrin and Sec7 domain containing 3 2 2
MIRT536588 ITPKB inositol-trisphosphate 3-kinase B 2 2
MIRT536779 HNRNPD heterogeneous nuclear ribonucleoprotein D 2 2
MIRT538764 CABLES1 Cdk5 and Abl enzyme substrate 1 2 2
MIRT539294 ANGEL2 angel homolog 2 2 2
MIRT539621 SHISA9 shisa family member 9 2 2
MIRT539651 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 2 2
MIRT540347 OPHN1 oligophrenin 1 2 2
MIRT540413 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 2 2
MIRT541396 CDC27 cell division cycle 27 2 2
MIRT542916 HSBP1 heat shock factor binding protein 1 2 2
MIRT544710 EIF5A eukaryotic translation initiation factor 5A 2 4
MIRT544998 MFF mitochondrial fission factor 2 4
MIRT553289 TSPAN3 tetraspanin 3 2 2
MIRT553455 TNRC6C trinucleotide repeat containing 6C 2 2
MIRT553782 TAF13 TATA-box binding protein associated factor 13 2 2
MIRT554656 ROBO1 roundabout guidance receptor 1 2 2
MIRT555104 PURB purine rich element binding protein B 2 2
MIRT557235 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT560861 GAL3ST3 galactose-3-O-sulfotransferase 3 2 2
MIRT561545 SON SON DNA binding protein 2 2
MIRT561554 SLMO2 PRELI domain containing 3B 2 2
MIRT563764 ZNF678 zinc finger protein 678 2 2
MIRT565653 SIX4 SIX homeobox 4 2 2
MIRT568080 CELF2 CUGBP Elav-like family member 2 2 2
MIRT568759 MYBL1 MYB proto-oncogene like 1 2 2
MIRT569078 CADM2 cell adhesion molecule 2 2 2
MIRT569509 THYN1 thymocyte nuclear protein 1 2 2
MIRT571268 CDKN2AIP CDKN2A interacting protein 2 2
MIRT571809 PHF19 PHD finger protein 19 2 2
MIRT572554 DKK3 dickkopf WNT signaling pathway inhibitor 3 2 2
MIRT573782 SLC24A4 solute carrier family 24 member 4 2 4
MIRT576441 Ccdc115 coiled-coil domain containing 115 2 10
MIRT576712 Slc30a3 solute carrier family 30 (zinc transporter), member 3 2 3
MIRT608377 PIWIL2 piwi like RNA-mediated gene silencing 2 2 2
MIRT608484 NKTR natural killer cell triggering receptor 2 6
MIRT610186 FAM49A family with sequence similarity 49 member A 2 2
MIRT611631 EDIL3 EGF like repeats and discoidin domains 3 2 2
MIRT613534 TRA2B transformer 2 beta homolog 2 2
MIRT616221 PTPN11 protein tyrosine phosphatase, non-receptor type 11 2 2
MIRT622370 SALL1 spalt like transcription factor 1 2 2
MIRT624371 CDK12 cyclin dependent kinase 12 2 2
MIRT624995 ZNF665 zinc finger protein 665 2 4
MIRT626875 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT627737 RAP2B RAP2B, member of RAS oncogene family 2 4
MIRT628490 ADAT2 adenosine deaminase, tRNA specific 2 2 2
MIRT633647 PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 2 4
MIRT634028 SLC30A3 solute carrier family 30 member 3 2 3
MIRT635923 GLTSCR2 NOP53 ribosome biogenesis factor 2 2
MIRT638287 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT641959 RNF115 ring finger protein 115 2 2
MIRT643573 CTNNA3 catenin alpha 3 2 2
MIRT645180 NOL9 nucleolar protein 9 2 4
MIRT647497 ZNF639 zinc finger protein 639 2 2
MIRT647682 PCK1 phosphoenolpyruvate carboxykinase 1 2 2
MIRT648422 MYOZ3 myozenin 3 2 2
MIRT650113 ZCCHC9 zinc finger CCHC-type containing 9 2 2
MIRT651076 ZNF518B zinc finger protein 518B 2 4
MIRT651415 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT651456 XKR4 XK related 4 2 2
MIRT653619 SLC30A4 solute carrier family 30 member 4 2 2
MIRT653637 SLC30A1 solute carrier family 30 member 1 2 2
MIRT654896 POU2F1 POU class 2 homeobox 1 2 2
MIRT656483 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT658016 GABRA4 gamma-aminobutyric acid type A receptor alpha4 subunit 2 2
MIRT658041 FZD10 frizzled class receptor 10 2 2
MIRT660093 BTBD3 BTB domain containing 3 2 2
MIRT663923 MAGEF1 MAGE family member F1 2 2
MIRT665882 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT669051 CEP128 centrosomal protein 128 2 2
MIRT669711 AAGAB alpha and gamma adaptin binding protein 2 2
MIRT686812 SNX2 sorting nexin 2 2 4
MIRT689883 SOD2 superoxide dismutase 2 2 2
MIRT693274 GLRX2 glutaredoxin 2 2 4
MIRT697056 BCAR1 BCAR1, Cas family scaffolding protein 2 2
MIRT703297 GID4 GID complex subunit 4 homolog 2 2
MIRT704087 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT707719 CDC6 cell division cycle 6 2 2
MIRT708136 GK5 glycerol kinase 5 (putative) 2 2
MIRT709212 KLHL30 kelch like family member 30 2 2
MIRT710062 RWDD2A RWD domain containing 2A 2 2
MIRT712770 POU6F2 POU class 6 homeobox 2 2 2
MIRT715073 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT715387 TADA3 transcriptional adaptor 3 2 2
MIRT717712 NCKAP1 NCK associated protein 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548t Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-548t Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-548t Doxorubicin 31703 NSC123127 approved sensitive cell line (W1)
hsa-mir-548t Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-548t Vincristine 5978 approved sensitive cell line (W1)
hsa-miR-548t-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-548t-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-548t-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)

Error report submission