pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-548t |
Genomic Coordinates | chr4: 173268160 - 173268233 |
Description | Homo sapiens miR-548t stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-548t-3p | |||||||||||||||||||||||||||||||||||
Sequence | 46| AAAAACCACAAUUACUUUUGCACCA |70 | |||||||||||||||||||||||||||||||||||
Evidence | Not_experimental | |||||||||||||||||||||||||||||||||||
Experiments | ||||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Slc30a3 | ||||||||||||||||||||
Synonyms | Znt3 | ||||||||||||||||||||
Description | solute carrier family 30 (zinc transporter), member 3 | ||||||||||||||||||||
Transcript | NM_011773 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Slc30a3 | |||||||||||||||||||||
3'UTR of Slc30a3 (miRNA target sites are highlighted) |
>Slc30a3|NM_011773|3'UTR 1 GCCTCAGCCCCACCCTCACCCCACTGCCAGGCCCAGGCTCTCGCCTGGACTCTCAGCACCTGCCTCCCAGATCAGAAGGG 81 ACCTCTCTCTCTCTCCATCTTCCACCTGCCAAAAGCCCTAGCCCATGCCCTGGTGGCCAAGACCAAAGTGTATATGAAGG 161 CAATGGGGGGAGGGGAGGCTCAGATTGAATAGCTGTAAGCAGTTCAGGGCTGTGGGGCGTGTGGAAGCCCTGCCATCCAT 241 GCTCCACATGGAGAGTCATGCTTGTCCCTCTACGATTCATGTGTCCCTGTGGCAGGCTGGCTGGCTAGCTGGGGACATCT 321 GCCTGTCTGTGTGCTGTTTATGTGTGCCTGTGCCTGGGGAGGTCATCAGGGGCCCCCCTCCCCATGTGACCCTTGCTCTG 401 TCTATGCAGCGGCCCCAAAGCCTGCACTTTGTTTGTGTGCCCTAGTCCTGTGGTTTTGTCTGTTGTGAATGTGTGTTCTT 481 TGGTGCTGTGGCCTGTGTGTCCCTGTGCCTGTGTAGCTGTGCTGGTTTGTGAGTCTGCTCCACCTGTGTGTCCATATGGG 561 ATCTGTCTGTCCATCCCTGTGTTGGTGCTGTGTCCTCAGCTTTCCCCAAGGGAGAGGGAGGACTCCACTGCAGCTCCACA 641 AATAAAAACTTGGATCTAACTGTAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HS5 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP聽 data was present in GSM1013105. RNA binding protein: AGO. Condition:HS5-replicate-2
... - Balakrishnan I; Yang X; Brown J; et al., 2014, Stem cells (Dayton, Ohio). |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Balakrishnan I; Yang X; Brown J; et al. - Stem cells (Dayton, Ohio), 2014
Regulation of hematopoietic stem cell proliferation, lineage commitment, and differentiation in adult vertebrates requires extrinsic signals provided by cells in the marrow microenvironment (ME) located within the bone marrow. Both secreted and cell-surface bound factors critical to this regulation have been identified, yet control of their expression by cells within the ME has not been addressed. Herein we hypothesize that microRNAs (miRNAs) contribute to their controlled expression. MiRNAs are small noncoding RNAs that bind to target mRNAs and downregulate gene expression by either initiating mRNA degradation or preventing peptide translation. Testing the role of miRNAs in downregulating gene expression has been difficult since conventional techniques used to define miRNA-mRNA interactions are indirect and have high false-positive and negative rates. In this report, a genome-wide biochemical technique (high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation or HITS-CLIP) was used to generate unbiased genome-wide maps of miRNA-mRNA interactions in two critical cellular components of the marrow ME: marrow stromal cells and bone marrow endothelial cells. Analysis of these datasets identified miRNAs as direct regulators of JAG1, WNT5A, MMP2, and VEGFA; four factors that are important to ME function. Our results show the feasibility and utility of unbiased genome-wide biochemical techniques in dissecting the role of miRNAs in regulation of complex tissues such as the marrow ME.
LinkOut: [PMID: 24038734]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP.
- Spengler RM; Zhang X; Cheng C; McLendon JM; et al.- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
|
CLIP-seq Support 1 for dataset GSM1084044 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep3 |
Location of target site | ENST00000233535.4 | 3UTR | UGUCUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1084046 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noarsenite_rep4 |
Location of target site | ENST00000233535.4 | 3UTR | UGUCUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1084047 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_arsenite_rep4 |
Location of target site | ENST00000233535.4 | 3UTR | UGUCUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1084064 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_AbnovaAb |
Location of target site | ENST00000233535.4 | 3UTR | UUUUGUCUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1084072 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_nohippuristanol_rep1_AbnovaAb |
Location of target site | ENST00000233535.4 | 3UTR | UGUCUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM1013105 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HS5 / HS5-replicate-2 |
Location of target site | ENST00000233535.4 | 3UTR | UGUCUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24038734 / GSE41272 |
CLIP-seq Viewer | Link |
168 hsa-miR-548t-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT059365 | ANP32E | acidic nuclear phosphoprotein 32 family member E | ![]() |
![]() |
2 | 2 | ||||||
MIRT072839 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT076945 | PCGF2 | polycomb group ring finger 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT083941 | TFAP2C | transcription factor AP-2 gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT085401 | ETS2 | ETS proto-oncogene 2, transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT109790 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT114046 | AKAP11 | A-kinase anchoring protein 11 | ![]() |
![]() |
2 | 10 | ||||||
MIRT130165 | TXNIP | thioredoxin interacting protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT150013 | MIDN | midnolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT181258 | ASH1L | ASH1 like histone lysine methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT205594 | NCL | nucleolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT222253 | ACTB | actin beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT245653 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT250947 | CDK5R1 | cyclin dependent kinase 5 regulatory subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT252497 | NWD1 | NACHT and WD repeat domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT271990 | ARF1 | ADP ribosylation factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT280804 | RNF11 | ring finger protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT293803 | FEM1A | fem-1 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT318231 | RREB1 | ras responsive element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT341455 | ATP6V0B | ATPase H+ transporting V0 subunit b | ![]() |
![]() |
2 | 2 | ||||||
MIRT347413 | CEBPG | CCAAT/enhancer binding protein gamma | ![]() |
![]() |
2 | 4 | ||||||
MIRT351860 | PLEKHA3 | pleckstrin homology domain containing A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT357983 | GRPEL2 | GrpE like 2, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT377094 | PPP1CB | protein phosphatase 1 catalytic subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT407303 | IGFBP5 | insulin like growth factor binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441564 | LMOD3 | leiomodin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442364 | ZC3H12C | zinc finger CCCH-type containing 12C | ![]() |
![]() |
2 | 2 | ||||||
MIRT443228 | ARL5B | ADP ribosylation factor like GTPase 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT443404 | HMX3 | H6 family homeobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446055 | NR5A2 | nuclear receptor subfamily 5 group A member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448277 | ZNF652 | zinc finger protein 652 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450822 | KCNB1 | potassium voltage-gated channel subfamily B member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453016 | CCDC115 | coiled-coil domain containing 115 | ![]() |
![]() |
2 | 17 | ||||||
MIRT454463 | PPP2R2B | protein phosphatase 2 regulatory subunit Bbeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT456360 | CITED2 | Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460007 | DNALI1 | dynein axonemal light intermediate chain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463154 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 6 | ||||||
MIRT463766 | YPEL2 | yippee like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468310 | SFT2D2 | SFT2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470668 | POLR2D | RNA polymerase II subunit D | ![]() |
![]() |
2 | 4 | ||||||
MIRT478517 | CTTN | cortactin | ![]() |
![]() |
2 | 2 | ||||||
MIRT480507 | C11orf57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484718 | INHBA | inhibin beta A subunit | ![]() |
![]() |
2 | 12 | ||||||
MIRT485494 | HMGN2 | high mobility group nucleosomal binding domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487302 | SLC38A9 | solute carrier family 38 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487771 | ANKEF1 | ankyrin repeat and EF-hand domain containing 1 | ![]() |
![]() |
2 | 16 | ||||||
MIRT491876 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT494304 | CEP120 | centrosomal protein 120 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495396 | TRIM24 | tripartite motif containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495646 | CDK1 | cyclin dependent kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496665 | TMEM237 | transmembrane protein 237 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496837 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498638 | CHD4 | chromodomain helicase DNA binding protein 4 | ![]() |
![]() |
2 | 10 | ||||||
MIRT503928 | FBXL13 | F-box and leucine rich repeat protein 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506063 | PPP2R2A | protein phosphatase 2 regulatory subunit Balpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT506582 | MIER3 | MIER family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506606 | MAT2A | methionine adenosyltransferase 2A | ![]() |
![]() |
2 | 4 | ||||||
MIRT506844 | KIF23 | kinesin family member 23 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508536 | RPP14 | ribonuclease P/MRP subunit p14 | ![]() |
![]() |
2 | 4 | ||||||
MIRT509669 | ZNF354B | zinc finger protein 354B | ![]() |
![]() |
2 | 10 | ||||||
MIRT511170 | MBNL3 | muscleblind like splicing regulator 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512147 | COX6B1 | cytochrome c oxidase subunit 6B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512831 | ID4 | inhibitor of DNA binding 4, HLH protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT514558 | XRCC3 | X-ray repair cross complementing 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT515856 | AJAP1 | adherens junctions associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT521848 | PNISR | PNN interacting serine and arginine rich protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT525364 | SYNM | synemin | ![]() |
![]() |
2 | 2 | ||||||
MIRT527120 | ARHGAP15 | Rho GTPase activating protein 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527271 | FBLN2 | fibulin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527439 | COL4A3 | collagen type IV alpha 3 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT527658 | CD300E | CD300e molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT528334 | TBC1D22B | TBC1 domain family member 22B | ![]() |
![]() |
2 | 2 | ||||||
MIRT529033 | EXOC8 | exocyst complex component 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529321 | PDE5A | phosphodiesterase 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT529677 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529846 | SMTN | smoothelin | ![]() |
![]() |
2 | 2 | ||||||
MIRT530385 | ZNF431 | zinc finger protein 431 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530913 | GPR85 | G protein-coupled receptor 85 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531794 | KDR | kinase insert domain receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT532246 | KLF2 | Kruppel like factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT532658 | CBX7 | chromobox 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533630 | TMX3 | thioredoxin related transmembrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534811 | RAB33B | RAB33B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT534975 | PSD3 | pleckstrin and Sec7 domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536588 | ITPKB | inositol-trisphosphate 3-kinase B | ![]() |
![]() |
2 | 2 | ||||||
MIRT536779 | HNRNPD | heterogeneous nuclear ribonucleoprotein D | ![]() |
![]() |
2 | 2 | ||||||
MIRT538764 | CABLES1 | Cdk5 and Abl enzyme substrate 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539294 | ANGEL2 | angel homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539621 | SHISA9 | shisa family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539651 | BUB1 | BUB1 mitotic checkpoint serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT540347 | OPHN1 | oligophrenin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540413 | PITPNC1 | phosphatidylinositol transfer protein, cytoplasmic 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541396 | CDC27 | cell division cycle 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542916 | HSBP1 | heat shock factor binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544710 | EIF5A | eukaryotic translation initiation factor 5A | ![]() |
![]() |
2 | 4 | ||||||
MIRT544998 | MFF | mitochondrial fission factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT553289 | TSPAN3 | tetraspanin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553455 | TNRC6C | trinucleotide repeat containing 6C | ![]() |
![]() |
2 | 2 | ||||||
MIRT553782 | TAF13 | TATA-box binding protein associated factor 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554656 | ROBO1 | roundabout guidance receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555104 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT557235 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560861 | GAL3ST3 | galactose-3-O-sulfotransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561545 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT561554 | SLMO2 | PRELI domain containing 3B | ![]() |
![]() |
2 | 2 | ||||||
MIRT563764 | ZNF678 | zinc finger protein 678 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565653 | SIX4 | SIX homeobox 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568080 | CELF2 | CUGBP Elav-like family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568759 | MYBL1 | MYB proto-oncogene like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569078 | CADM2 | cell adhesion molecule 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569509 | THYN1 | thymocyte nuclear protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571268 | CDKN2AIP | CDKN2A interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT571809 | PHF19 | PHD finger protein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572554 | DKK3 | dickkopf WNT signaling pathway inhibitor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573782 | SLC24A4 | solute carrier family 24 member 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT576441 | Ccdc115 | coiled-coil domain containing 115 | ![]() |
![]() |
2 | 10 | ||||||
MIRT576712 | Slc30a3 | solute carrier family 30 (zinc transporter), member 3 | ![]() |
![]() |
2 | 3 | ||||||
MIRT608377 | PIWIL2 | piwi like RNA-mediated gene silencing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608484 | NKTR | natural killer cell triggering receptor | ![]() |
![]() |
2 | 6 | ||||||
MIRT610186 | FAM49A | family with sequence similarity 49 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT611631 | EDIL3 | EGF like repeats and discoidin domains 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613534 | TRA2B | transformer 2 beta homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT616221 | PTPN11 | protein tyrosine phosphatase, non-receptor type 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622370 | SALL1 | spalt like transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624371 | CDK12 | cyclin dependent kinase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624995 | ZNF665 | zinc finger protein 665 | ![]() |
![]() |
2 | 4 | ||||||
MIRT626875 | AP3B1 | adaptor related protein complex 3 beta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT627737 | RAP2B | RAP2B, member of RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT628490 | ADAT2 | adenosine deaminase, tRNA specific 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633647 | PLEKHG7 | pleckstrin homology and RhoGEF domain containing G7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT634028 | SLC30A3 | solute carrier family 30 member 3 | ![]() |
![]() |
2 | 3 | ||||||
MIRT635923 | GLTSCR2 | NOP53 ribosome biogenesis factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT638287 | SERBP1 | SERPINE1 mRNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641959 | RNF115 | ring finger protein 115 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643573 | CTNNA3 | catenin alpha 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645180 | NOL9 | nucleolar protein 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT647497 | ZNF639 | zinc finger protein 639 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647682 | PCK1 | phosphoenolpyruvate carboxykinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648422 | MYOZ3 | myozenin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650113 | ZCCHC9 | zinc finger CCHC-type containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651076 | ZNF518B | zinc finger protein 518B | ![]() |
![]() |
2 | 4 | ||||||
MIRT651415 | ZADH2 | zinc binding alcohol dehydrogenase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651456 | XKR4 | XK related 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653619 | SLC30A4 | solute carrier family 30 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653637 | SLC30A1 | solute carrier family 30 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654896 | POU2F1 | POU class 2 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656483 | MAP3K9 | mitogen-activated protein kinase kinase kinase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658016 | GABRA4 | gamma-aminobutyric acid type A receptor alpha4 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT658041 | FZD10 | frizzled class receptor 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660093 | BTBD3 | BTB domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663923 | MAGEF1 | MAGE family member F1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665882 | TGIF2 | TGFB induced factor homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669051 | CEP128 | centrosomal protein 128 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669711 | AAGAB | alpha and gamma adaptin binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT686812 | SNX2 | sorting nexin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT689883 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693274 | GLRX2 | glutaredoxin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT697056 | BCAR1 | BCAR1, Cas family scaffolding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT703297 | GID4 | GID complex subunit 4 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT704087 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707719 | CDC6 | cell division cycle 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708136 | GK5 | glycerol kinase 5 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT709212 | KLHL30 | kelch like family member 30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710062 | RWDD2A | RWD domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT712770 | POU6F2 | POU class 6 homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715073 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715387 | TADA3 | transcriptional adaptor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717712 | NCKAP1 | NCK associated protein 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|