pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-5691 |
Genomic Coordinates | chr11: 9090312 - 9090379 |
Description | Homo sapiens miR-5691 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-5691 | |||||||||||||||
Sequence | 9| UUGCUCUGAGCUCCGAGAAAGC |30 | |||||||||||||||
Evidence | Experimental | |||||||||||||||
Experiments | Illumina | |||||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Wars | ||||||||||||||||||||
Synonyms | TrpRS, WRS | ||||||||||||||||||||
Description | tryptophanyl-tRNA synthetase | ||||||||||||||||||||
Transcript | NM_001164314 | ||||||||||||||||||||
Other Transcripts | NM_001164488 , NM_011710 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Wars | |||||||||||||||||||||
3'UTR of Wars (miRNA target sites are highlighted) |
>Wars|NM_001164314|3'UTR 1 TGTCTCTTTTCTGTGGCAAGCCTGTCTGTAACCCACCCTGTCAAATCAAGTCACACTCCCAATAGGCTTCTCACGTGGTA 81 ATTCCTGGACCTGGGTCTCTGTGCACGTGTGCATCCTGGATGCTGTTTCTTCTCTGATGTCTCCCCGTCTGTTGTCTGCT 161 ACGGGTGATCAAGCGATGCTAATGTTGTGTGGTCAGATAGAACCCCAGCCCGCAGTCTCTCCCACAAAGAGCCCAGAGGT 241 AGTGCTTCCCTGGCCCACAGAAGACTGTCCAGCTAGCAGCCTGGGGTTCCAGAACAAATTCTGAAATGTATTCCAGTTTT 321 TCTTTAAAGTGCGTGTGCCCGGTTGGCCACGGTGGGGTGCACTGTATCATCTCTGTTCTCAGGAGGCTGAGACACGAGGT 401 CTGAGCCAGCCTGGTAGTAATCTGCCTTTGATTCTGCTGCTGTGGAGTCACAATGTCATTACTGTAAAACTGAACACTGC 481 TGTGAGGAACTGACAAGGAGACATGTAGTGGGACATGCCGCTGCTCCAGCCCACGCCCCCCCCCACACACGCACACACAC 561 TTACATGTAATGTGTGCAAACTTTGCTTTATACTTGGCTAAGAAGCCATCAGCTTTGTTCTGAAGGTGTAGCTCAGTAGT 641 AGAGCACTCGCCTAGCACGCCTGCTGGCCCGGGTTCAGTCTCCTGCCCCACGAAGCCGGGCGGATAACTGAGCTCTCTGC 721 TTTTAACCCTGATTATGGACCAGGCTGGGTCTTTCCACTAACCTGAGGCTGAGGTAGCTAACCTCCAGCTCCCGTGTGCC 801 GTCCACTCCAAAATCATGCTTGCGCCCTTGGTGTACTAACTTCCCCACAGATGGCCCAGACTCCACCCTGTGACGTGCAG 881 GGCTGCAGCTCCTGACCCCCGGGTCCTGAGGACGGCTTGTTCCCTTTGCAGGTGCTTCTGCTTTGACACTTGACTGACGG 961 GGAGGGCAGGCCAGAGCAGTGTGCTGGCCATGCCTCAGGCCGTTGACCATAGCTAGACAGAAAAGAACAGCAGCCGTCCA 1041 GGCCGCAGCGTTCTCCCTCTGGGCGGGCTGCATGGAATGAGCCTCCACTCAGAGTCTTGGAAAAGCAGAAGCCGTACCTC 1121 AGGGAAAGCCCCTGGTTGAAGTGTCTGTCCTCTCTGAAGGCACAAGGGCCACTCTGAGTGTTCTGTCCTTGCATCATTTT 1201 TAGGAAAAAACAATAAACTTTGTTGAGCTCCTGTC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HS5 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP聽 data was present in GSM1013105. RNA binding protein: AGO. Condition:HS5-replicate-2
... - Balakrishnan I; Yang X; Brown J; et al., 2014, Stem cells (Dayton, Ohio). |
Article |
- Balakrishnan I; Yang X; Brown J; et al. - Stem cells (Dayton, Ohio), 2014
Regulation of hematopoietic stem cell proliferation, lineage commitment, and differentiation in adult vertebrates requires extrinsic signals provided by cells in the marrow microenvironment (ME) located within the bone marrow. Both secreted and cell-surface bound factors critical to this regulation have been identified, yet control of their expression by cells within the ME has not been addressed. Herein we hypothesize that microRNAs (miRNAs) contribute to their controlled expression. MiRNAs are small noncoding RNAs that bind to target mRNAs and downregulate gene expression by either initiating mRNA degradation or preventing peptide translation. Testing the role of miRNAs in downregulating gene expression has been difficult since conventional techniques used to define miRNA-mRNA interactions are indirect and have high false-positive and negative rates. In this report, a genome-wide biochemical technique (high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation or HITS-CLIP) was used to generate unbiased genome-wide maps of miRNA-mRNA interactions in two critical cellular components of the marrow ME: marrow stromal cells and bone marrow endothelial cells. Analysis of these datasets identified miRNAs as direct regulators of JAG1, WNT5A, MMP2, and VEGFA; four factors that are important to ME function. Our results show the feasibility and utility of unbiased genome-wide biochemical techniques in dissecting the role of miRNAs in regulation of complex tissues such as the marrow ME.
LinkOut: [PMID: 24038734]
|
CLIP-seq Support 1 for dataset GSM1013105 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HS5 / HS5-replicate-2 |
Location of target site | ENST00000392882.2 | 3UTR | CUAGGCAGGCCUCAUUUCAUCACGCAGCAUGUGCAGGCCUGGAAGAGCAAAGCCAAAUCUCAGGGAAGUCCUUGGUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24038734 / GSE41272 |
CLIP-seq Viewer | Link |
91 hsa-miR-5691 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT091162 | TBL1XR1 | transducin beta like 1 X-linked receptor 1 | 2 | 2 | ||||||||
MIRT242227 | TTC9 | tetratricopeptide repeat domain 9 | 2 | 4 | ||||||||
MIRT246192 | TXNIP | thioredoxin interacting protein | 2 | 2 | ||||||||
MIRT251553 | DCAF7 | DDB1 and CUL4 associated factor 7 | 2 | 4 | ||||||||
MIRT387267 | SOX9 | SRY-box 9 | 2 | 2 | ||||||||
MIRT463486 | ZC3H11A | zinc finger CCCH-type containing 11A | 2 | 12 | ||||||||
MIRT494446 | BTG2 | BTG anti-proliferation factor 2 | 2 | 2 | ||||||||
MIRT496478 | ADAMTS17 | ADAM metallopeptidase with thrombospondin type 1 motif 17 | 2 | 2 | ||||||||
MIRT501825 | NCOA3 | nuclear receptor coactivator 3 | 2 | 2 | ||||||||
MIRT503072 | C6orf120 | chromosome 6 open reading frame 120 | 2 | 2 | ||||||||
MIRT504755 | TEP1 | telomerase associated protein 1 | 2 | 4 | ||||||||
MIRT505971 | RAB11FIP1 | RAB11 family interacting protein 1 | 2 | 4 | ||||||||
MIRT511868 | GOLGA7 | golgin A7 | 2 | 6 | ||||||||
MIRT512900 | UBL4A | ubiquitin like 4A | 2 | 2 | ||||||||
MIRT513048 | LYPD6 | LY6/PLAUR domain containing 6 | 2 | 6 | ||||||||
MIRT523772 | FAM83D | family with sequence similarity 83 member D | 2 | 2 | ||||||||
MIRT525126 | RPS11 | ribosomal protein S11 | 2 | 2 | ||||||||
MIRT525816 | VIMP | selenoprotein S | 2 | 10 | ||||||||
MIRT531222 | HIST1H2BD | histone cluster 1 H2B family member d | 2 | 2 | ||||||||
MIRT531729 | SLC2A9 | solute carrier family 2 member 9 | 2 | 2 | ||||||||
MIRT536282 | LIMA1 | LIM domain and actin binding 1 | 2 | 2 | ||||||||
MIRT537291 | G3BP1 | G3BP stress granule assembly factor 1 | 2 | 2 | ||||||||
MIRT537724 | ELAVL2 | ELAV like RNA binding protein 2 | 2 | 2 | ||||||||
MIRT547940 | HNRNPA0 | heterogeneous nuclear ribonucleoprotein A0 | 2 | 2 | ||||||||
MIRT554177 | SLC35E2B | solute carrier family 35 member E2B | 2 | 2 | ||||||||
MIRT555015 | RAB2B | RAB2B, member RAS oncogene family | 2 | 2 | ||||||||
MIRT576717 | Wars | tryptophanyl-tRNA synthetase | 2 | 2 | ||||||||
MIRT607484 | HEBP2 | heme binding protein 2 | 2 | 2 | ||||||||
MIRT610786 | KLK2 | kallikrein related peptidase 2 | 2 | 2 | ||||||||
MIRT611491 | ZNF440 | zinc finger protein 440 | 2 | 2 | ||||||||
MIRT613986 | DBT | dihydrolipoamide branched chain transacylase E2 | 2 | 2 | ||||||||
MIRT615782 | KIAA0319L | KIAA0319 like | 2 | 2 | ||||||||
MIRT620563 | WBSCR27 | methyltransferase like 27 | 2 | 4 | ||||||||
MIRT624157 | DGKE | diacylglycerol kinase epsilon | 2 | 2 | ||||||||
MIRT626088 | MKLN1 | muskelin 1 | 2 | 2 | ||||||||
MIRT629481 | GSN | gelsolin | 2 | 2 | ||||||||
MIRT636645 | CDK4 | cyclin dependent kinase 4 | 2 | 2 | ||||||||
MIRT638074 | HS3ST1 | heparan sulfate-glucosamine 3-sulfotransferase 1 | 2 | 2 | ||||||||
MIRT638442 | PLXDC2 | plexin domain containing 2 | 2 | 2 | ||||||||
MIRT641025 | KLHL7 | kelch like family member 7 | 2 | 2 | ||||||||
MIRT641539 | MOCOS | molybdenum cofactor sulfurase | 2 | 2 | ||||||||
MIRT643004 | ZNF829 | zinc finger protein 829 | 2 | 2 | ||||||||
MIRT643092 | NDUFB5 | NADH:ubiquinone oxidoreductase subunit B5 | 2 | 2 | ||||||||
MIRT644979 | IL2RA | interleukin 2 receptor subunit alpha | 2 | 2 | ||||||||
MIRT645912 | PLXNA3 | plexin A3 | 2 | 2 | ||||||||
MIRT646605 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | 2 | 2 | ||||||||
MIRT648033 | FADS6 | fatty acid desaturase 6 | 2 | 2 | ||||||||
MIRT657491 | HBEGF | heparin binding EGF like growth factor | 2 | 2 | ||||||||
MIRT658381 | FAM26E | calcium homeostasis modulator family member 5 | 2 | 2 | ||||||||
MIRT659695 | CD200 | CD200 molecule | 2 | 2 | ||||||||
MIRT661276 | TEX9 | testis expressed 9 | 2 | 2 | ||||||||
MIRT661348 | DYRK4 | dual specificity tyrosine phosphorylation regulated kinase 4 | 2 | 2 | ||||||||
MIRT662948 | JPH2 | junctophilin 2 | 2 | 2 | ||||||||
MIRT663225 | PPY | pancreatic polypeptide | 2 | 2 | ||||||||
MIRT663280 | SPN | sialophorin | 2 | 2 | ||||||||
MIRT663335 | ZNF74 | zinc finger protein 74 | 2 | 2 | ||||||||
MIRT664344 | C16orf45 | chromosome 16 open reading frame 45 | 2 | 2 | ||||||||
MIRT664855 | TBRG4 | transforming growth factor beta regulator 4 | 2 | 2 | ||||||||
MIRT665484 | VPS53 | VPS53, GARP complex subunit | 2 | 2 | ||||||||
MIRT666428 | SH2B3 | SH2B adaptor protein 3 | 2 | 2 | ||||||||
MIRT668162 | GDE1 | glycerophosphodiester phosphodiesterase 1 | 2 | 2 | ||||||||
MIRT670170 | CCDC142 | coiled-coil domain containing 142 | 2 | 2 | ||||||||
MIRT671277 | MTO1 | mitochondrial tRNA translation optimization 1 | 2 | 2 | ||||||||
MIRT672284 | GP2 | glycoprotein 2 | 2 | 2 | ||||||||
MIRT672435 | RAB10 | RAB10, member RAS oncogene family | 2 | 2 | ||||||||
MIRT672646 | SLC25A16 | solute carrier family 25 member 16 | 2 | 4 | ||||||||
MIRT672760 | UBE2V2 | ubiquitin conjugating enzyme E2 V2 | 2 | 2 | ||||||||
MIRT672834 | AKR7L | aldo-keto reductase family 7 like (gene/pseudogene) | 2 | 2 | ||||||||
MIRT672841 | ICOSLG | inducible T-cell costimulator ligand | 2 | 2 | ||||||||
MIRT673080 | AK1 | adenylate kinase 1 | 2 | 2 | ||||||||
MIRT673148 | C1orf50 | chromosome 1 open reading frame 50 | 2 | 2 | ||||||||
MIRT673323 | THAP1 | THAP domain containing 1 | 2 | 2 | ||||||||
MIRT673893 | DCTN6 | dynactin subunit 6 | 2 | 2 | ||||||||
MIRT674182 | PLEKHM3 | pleckstrin homology domain containing M3 | 2 | 2 | ||||||||
MIRT674607 | RBBP4 | RB binding protein 4, chromatin remodeling factor | 2 | 2 | ||||||||
MIRT674740 | SLC16A1 | solute carrier family 16 member 1 | 2 | 2 | ||||||||
MIRT675140 | MOGAT1 | monoacylglycerol O-acyltransferase 1 | 2 | 4 | ||||||||
MIRT675194 | NKPD1 | NTPase KAP family P-loop domain containing 1 | 2 | 2 | ||||||||
MIRT675886 | SNAP29 | synaptosome associated protein 29 | 2 | 2 | ||||||||
MIRT679163 | PSMB2 | proteasome subunit beta 2 | 2 | 2 | ||||||||
MIRT680337 | ZNF281 | zinc finger protein 281 | 2 | 2 | ||||||||
MIRT706699 | GPR155 | G protein-coupled receptor 155 | 2 | 2 | ||||||||
MIRT706911 | THAP6 | THAP domain containing 6 | 2 | 2 | ||||||||
MIRT707880 | SLC45A4 | solute carrier family 45 member 4 | 2 | 2 | ||||||||
MIRT709097 | SEPT4 | septin 4 | 2 | 2 | ||||||||
MIRT709408 | FBXL20 | F-box and leucine rich repeat protein 20 | 2 | 2 | ||||||||
MIRT710845 | FAM210A | family with sequence similarity 210 member A | 2 | 2 | ||||||||
MIRT711358 | VPS8 | VPS8, CORVET complex subunit | 2 | 2 | ||||||||
MIRT718590 | SCD5 | stearoyl-CoA desaturase 5 | 2 | 2 | ||||||||
MIRT723649 | RPTN | repetin | 2 | 2 | ||||||||
MIRT724208 | NUP205 | nucleoporin 205 | 2 | 2 |