>Poteg|NM_026256|3'UTR
   1 ATGTTTACTAGTGGGCTGGATGCCATGTCCGTACATGGAAGGTTAGTCGACAGAAACAAGAGTGTGAGCAGGCTAAAACA
  81 CTTATCAATTTGGTAAGCAATCAGAAGGATTGGTGGTAACTACTTTGATGTCCTAGGCAAATGTGTCAAAATATGGAGCC
 161 CAAGAGAAATTGCATTGTTTCCAACAATAGAGGAAACTTTAAACTTGGCCAGTGAGTGTTTGGATAAACATAATTTTTAT
 241 TTTCTAGG

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ucUCCGUC---CAAGGACCUAGUa 5' :| ||| || ::||||| | Target 5' ttGGCCAGTGAGTGTTTGGATAAa 3'	205 - 228	123.00	-10.32
2	miRNA 3' ucucCGUCCAAGGACCUAgua 5' |::|| |||||| Target 5' actaGTGGG---CTGGATgcc 3'	7 - 24	110.00	-8.62
3	miRNA 3' ucUCCGUCCAAGGACCUAGUa 5' ||||| || :||| Target 5' ctAGGCA----AATGTGTCAa 3'	133 - 149	97.00	-6.40

- Stem cells (Dayton, Ohio), 2014

Regulation of hematopoietic stem cell proliferation, lineage commitment, and differentiation in adult vertebrates requires extrinsic signals provided by cells in the marrow microenvironment (ME) located within the bone marrow. Both secreted and cell-surface bound factors critical to this regulation have been identified, yet control of their expression by cells within the ME has not been addressed. Herein we hypothesize that microRNAs (miRNAs) contribute to their controlled expression. MiRNAs are small noncoding RNAs that bind to target mRNAs and downregulate gene expression by either initiating mRNA degradation or preventing peptide translation. Testing the role of miRNAs in downregulating gene expression has been difficult since conventional techniques used to define miRNA-mRNA interactions are indirect and have high false-positive and negative rates. In this report, a genome-wide biochemical technique (high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation or HITS-CLIP) was used to generate unbiased genome-wide maps of miRNA-mRNA interactions in two critical cellular components of the marrow ME: marrow stromal cells and bone marrow endothelial cells. Analysis of these datasets identified miRNAs as direct regulators of JAG1, WNT5A, MMP2, and VEGFA; four factors that are important to ME function. Our results show the feasibility and utility of unbiased genome-wide biochemical techniques in dissecting the role of miRNAs in regulation of complex tissues such as the marrow ME.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.