miRTarBase - #MIRT577003


—
pre-miRNA Information
pre-miRNA mmu-mir-129-1   
Genomic Coordinates chr6: 29022619 - 29022691
Description Mus musculus miR-129-1 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
pre-miRNA mmu-mir-129-2   
Genomic Coordinates chr2: 94241364 - 94241453
Description Mus musculus miR-129-2 stem-loop
Comment The miRNA from the 5' arm of this precursor was verified by cloning in mouse .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-129-5p
Sequence 15| CUUUUUGCGGUCUGGGCUUGC |35
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Gpx5   
Synonyms AV379049, Arep
Description glutathione peroxidase 5
Transcript NM_010343   
Expression
Putative miRNA Targets on Gpx5
3'UTR of Gpx5
(miRNA target sites are highlighted)		 
>Gpx5|NM_010343|3'UTR
   1 GAAGGCCAAGCTTCTGACCTCTTCCTCCTTCCCCCTTAAAGACTGCTCTGAAAAAAAGACTCCATCTTCTCAGCACACTC
  81 TTCACTGAAATGGACTCTACCTCCCCAAGTCACCCCTAAATTGCCTAAGTTCTTCCCCTGCACAAGTAGATTTGTGTCTG
 161 GGAAGCTGTAGATGTTTTTCCTTGTTAGATTTATGAGTTGAAGAGAGAAAATAAAAGAAAAAAGAAAAAGCTAAATCCAG
 241 AGACCTCAGAGGTTTGGCTGAGTATGTTAGTACTCACCTATAATGTCAGCACTCAGCAGACATTACAGACATTTCAGACA
 321 GGCAGCGACAGGAGGAACATGAATGGCAGGCCAGCCTAAGCTACAAGATATCATGTGTCCAAAAAAAAAAAAAAAAAAAT
 401 CCACCACCACCAACACAACCCGATTGAACTACTCTAATTCACCAAAGGATATGGGGATAGCTTGGTTGGAGGCTGTATCT
 481 GAAGGAAGAGTCCCCTTGGCCATTCTGAGTCTTTCTCTTCCCAGCCTGAAGGTGGAGAAAGAGCAATGGAGGCTGGTCAG
 561 ACAATCTAGTTTGCTCCTCTGAAACTGTGTGTCTCCTGAGACAAATGCCTTGTCAGTTCCTGAGGTCTTTTAATTCGGTC
 641 TTCATCTCTGTCTCCATCCTCTCTGCCCTTCTCCTGCGGCCAATCTGAGGGAGAGTCTGAGCAGATTGACTCGCACAGGA
 721 GGAGGGCATCTCCCTGATGCCAGGATCGGGGACTTGTCCCTGATTCTGCATAAGTGCTCCTTTCTGTGTGATCTTCACGG
 801 GGTCAGCTAGTGCTTATGAGTGGGGATGCCTTTCATCATCTGAAGAATAGGACCCCCCACATACACACCCCAACCTGGGA
 881 TTCTTCAACTTCAGAACTAGACATATTATTTCCAATAAAATGTTTTCTGAAGCATTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgUUCGGGUCUGGCGUUUUUc 5'
            ||| |::  |:| ||||| 
Target 5' taAAGACTGCTCTGAAAAAAa 3'
 37 - 57 127.00 -7.80
2 
miRNA  3' cguucGGGUCU--GGCGUUUUUc 5'
               ||| ||  |:||| ||: 
Target 5' cttgtCCCTGATTCTGCATAAGt 3'
 753 - 775 110.00 -12.30
3 
miRNA  3' cguUCGGG--UCUGGCGUUUUUc 5'
             ||||:  ||: :| |:||| 
Target 5' cccAGCCTGAAGG-TGGAGAAAg 3'
 520 - 541 107.00 -13.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Primary Keratinocytes
Disease 14780.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM1613682. RNA binding protein: AGO2. Condition:Ago2-HITS-CLIP ...

- Riemondy K; Wang XJ; Torchia EC; Roop DR; Yi R, 2015, eLife.

Article - Riemondy K; Wang XJ; Torchia EC; Roop DR; Yi R
- eLife, 2015
In many mouse models of skin cancer, only a few tumors typically form even though many cells competent for tumorigenesis receive the same oncogenic stimuli. These observations suggest an active selection process for tumor-initiating cells. Here, we use quantitative mRNA- and miR-Seq to determine the impact of Hras(G12V) on the transcriptome of keratinocytes. We discover that microRNA-203 is downregulated by Hras(G12V). Using a knockout mouse model, we demonstrate that loss of microRNA-203 promotes selection and expansion of tumor-initiating cells. Conversely, restoration of microRNA-203 using an inducible model potently inhibits proliferation of these cells. We comprehensively identify microRNA-203 targets required for Hras-initiated tumorigenesis. These targets include critical regulators of the Ras pathway and essential genes required for cell division. This study establishes a role for the loss of microRNA-203 in promoting selection and expansion of Hras mutated cells and identifies a mechanism through which microRNA-203 antagonizes Hras-mediated tumorigenesis.
LinkOut: [PMID: 26203562]
CLIP-seq Support 1 for dataset GSM1613682
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Primary Keratinocytes / Ago2-HITS-CLIP, biological rep.4
Location of target site NM_010343 | 3UTR | CAAAAAAAAAAAAAAAAAAAUCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 26203562 / GSE66056
CLIP-seq Viewer Link
350 mmu-miR-129-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT415357 Map3k1 mitogen-activated protein kinase kinase kinase 1 2 2
MIRT417807 Cbx6 chromobox 6 2 2
MIRT576977 Triml1 tripartite motif family-like 1 2 2
MIRT576990 Pknox1 Pbx/knotted 1 homeobox 2 4
MIRT576994 Mrpl17 mitochondrial ribosomal protein L17 2 2
MIRT577003 Gpx5 glutathione peroxidase 5 2 2
MIRT577024 Fndc3b fibronectin type III domain containing 3B 2 4
MIRT577372 Ybey ybeY metallopeptidase 2 2
MIRT577527 Tirap toll-interleukin 1 receptor (TIR) domain-containing adaptor protein 2 4
MIRT577532 Timm17b translocase of inner mitochondrial membrane 17b 2 4
MIRT577614 Stx8 syntaxin 8 2 4
MIRT577649 Smyd4 SET and MYND domain containing 4 2 2
MIRT578346 Lsm12 LSM12 homolog 2 4
MIRT578383 Kremen2 kringle containing transmembrane protein 2 2 2
MIRT578816 Fkbp6 FK506 binding protein 6 2 6
MIRT578986 Daxx Fas death domain-associated protein 2 4
MIRT578999 Cytip cytohesin 1 interacting protein 2 4
MIRT579175 Cd3eap CD3E antigen, epsilon polypeptide associated protein 2 2
MIRT579562 Oacyl O-acyltransferase like 1 1
MIRT579610 4930430F08Rik RIKEN cDNA 4930430F08 gene 2 2
MIRT579647 2510049J12Rik makorin, ring finger protein 2, opposite strand 2 4
MIRT579654 2010012O05Rik BLOC-1 related complex subunit 7 2 6
MIRT579679 Ccdc167 coiled-coil domain containing 167 1 1
MIRT579687 Zzz3 zinc finger, ZZ domain containing 3 2 4
MIRT579798 Zfp280d zinc finger protein 280D 2 2
MIRT579949 Xpo7 exportin 7 2 4
MIRT580023 Whsc1 nuclear receptor binding SET domain protein 2 2 4
MIRT580332 Tnfaip1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 2 2
MIRT580338 Tmod1 tropomodulin 1 2 2
MIRT580489 Tgoln1 trans-golgi network protein 2 2
MIRT580780 Sp3 trans-acting transcription factor 3 2 4
MIRT581221 Runx2 runt related transcription factor 2 2 2
MIRT581224 Runx1t1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 2 4
MIRT581264 Rragb Ras-related GTP binding B 2 2
MIRT581399 Rbm47 RNA binding motif protein 47 2 4
MIRT581985 Pcnp PEST proteolytic signal containing nuclear protein 2 2
MIRT582039 Otud7b OTU domain containing 7B 2 4
MIRT582362 Mtf2 metal response element binding transcription factor 2 2 2
MIRT582419 Mmp11 matrix metallopeptidase 11 2 2
MIRT582478 Med13 mediator complex subunit 13 2 2
MIRT582814 Jdp2 Jun dimerization protein 2 2 2
MIRT582931 Il11 interleukin 11 2 4
MIRT583199 Grb14 growth factor receptor bound protein 14 2 2
MIRT583261 Gnaz guanine nucleotide binding protein, alpha z subunit 2 2
MIRT583385 G3bp2 GTPase activating protein (SH3 domain) binding protein 2 2 2
MIRT583670 Fam160b1 family with sequence similarity 160, member B1 2 2
MIRT583679 Fam126b family with sequence similarity 126, member B 2 4
MIRT583681 Amer1 APC membrane recruitment 1 1 1
MIRT583843 Efna5 ephrin A5 2 4
MIRT584076 Ctbp2 C-terminal binding protein 2 2 4
MIRT584187 Cpeb3 cytoplasmic polyadenylation element binding protein 3 2 4
MIRT584339 Cdyl2 chromodomain protein, Y chromosome-like 2 2 2
MIRT584386 Cdh12 cadherin 12 2 2
MIRT584490 Camta1 calmodulin binding transcription activator 1 2 2
MIRT584511 Cadm2 cell adhesion molecule 2 2 4
MIRT584561 Brd4 bromodomain containing 4 2 2
MIRT584710 Atxn1 ataxin 1 2 2
MIRT584926 Agl amylo-1,6-glucosidase, 4-alpha-glucanotransferase 2 2
MIRT585045 Ptchd4 patched domain containing 4 1 2
MIRT585090 Zmat1 zinc finger, matrin type 1 2 2
MIRT585122 Zfp933 zinc finger protein 933 2 2
MIRT585460 Ube2c ubiquitin-conjugating enzyme E2C 2 4
MIRT585531 Trim39 tripartite motif-containing 39 2 2
MIRT585580 Tpm3 tropomyosin 3, gamma 2 2
MIRT585640 Tmem50a transmembrane protein 50A 2 2
MIRT585775 Spc24 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) 2 2
MIRT585864 Slc23a1 solute carrier family 23 (nucleobase transporters), member 1 2 2
MIRT585898 Slc17a8 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 2 2
MIRT586597 Mob3c MOB kinase activator 3C 1 1
MIRT586634 Mettl2 methyltransferase like 2 2 2
MIRT586644 Med16 mediator complex subunit 16 2 2
MIRT586751 Kif1c kinesin family member 1C 2 4
MIRT586782 Jakmip1 janus kinase and microtubule interacting protein 1 2 2
MIRT586872 Hyal1 hyaluronoglucosaminidase 1 2 2
MIRT586967 Gprc5c G protein-coupled receptor, family C, group 5, member C 2 2
MIRT587082 Glrx2 glutaredoxin 2 (thioltransferase) 2 2
MIRT587170 Gad2 glutamic acid decarboxylase 2 2 4
MIRT587334 Egfr epidermal growth factor receptor 2 2
MIRT587934 Atpbd4 diphthamine biosynthesis 6 2 2
MIRT587947 Asph aspartate-beta-hydroxylase 2 4
MIRT587974 Arpc4 actin related protein 2/3 complex, subunit 4 2 2
MIRT588081 Agtrap angiotensin II, type I receptor-associated protein 2 2
MIRT588092 Afg3l1 AFG3-like AAA ATPase 1 2 4
MIRT588135 A830018L16Rik RIKEN cDNA A830018L16 gene 2 2
MIRT588348 Zfp568 zinc finger protein 568 2 2
MIRT588382 Zfp131 zinc finger protein 131 2 2
MIRT588453 Ybx1 Y box protein 1 2 2
MIRT588755 Synj1 synaptojanin 1 2 2
MIRT588762 Stxbp5 syntaxin binding protein 5 (tomosyn) 2 4
MIRT589047 Rfx3 regulatory factor X, 3 (influences HLA class II expression) 2 2
MIRT589148 Rad18 RAD18 E3 ubiquitin protein ligase 2 2
MIRT589224 Prdm16 PR domain containing 16 2 2
MIRT589288 Pik3c2a phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 2 2
MIRT589417 Nras neuroblastoma ras oncogene 2 4
MIRT589442 Ncl nucleolin 2 2
MIRT589528 Mob4 MOB family member 4, phocein 1 1
MIRT589562 Mau2 MAU2 sister chromatid cohesion factor 2 4
MIRT589580 Magt1 magnesium transporter 1 2 4
MIRT589725 Kif11 kinesin family member 11 2 2
MIRT589752 Jhdm1d lysine (K)-specific demethylase 7A 2 2
MIRT589850 Hif1a hypoxia inducible factor 1, alpha subunit 2 2
MIRT589963 Gabpb2 GA repeat binding protein, beta 2 2 4
MIRT589997 Fsd1l fibronectin type III and SPRY domain containing 1-like 2 4
MIRT590506 Btg1 B cell translocation gene 1, anti-proliferative 2 2
MIRT590634 Arhgef9 CDC42 guanine nucleotide exchange factor (GEF) 9 2 2
MIRT590768 Crebrf CREB3 regulatory factor 1 1
MIRT590773 5730455P16Rik RIKEN cDNA 5730455P16 gene 2 2
MIRT590782 Epg5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT590981 Slc7a10 solute carrier family 7 (cationic amino acid transporter, y+ system), member 10 2 4
MIRT591495 Apba2 amyloid beta (A4) precursor protein-binding, family A, member 2 2 2
MIRT592320 Dbndd2 dysbindin (dystrobrevin binding protein 1) domain containing 2 2 2
MIRT593576 Zyg11b zyg-ll family member B, cell cycle regulator 2 2
MIRT593584 Zfp329 zinc finger protein 329 2 2
MIRT593585 Zbtb21 zinc finger and BTB domain containing 21 1 1
MIRT593587 Zfp26 zinc finger protein 26 2 2
MIRT593590 Yipf5 Yip1 domain family, member 5 2 2
MIRT593605 Veph1 ventricular zone expressed PH domain-containing 1 2 2
MIRT593606 Vcan versican 2 2
MIRT593609 Usp2 ubiquitin specific peptidase 2 2 2
MIRT593614 Ubxn2b UBX domain protein 2B 2 2
MIRT593637 Tcf23 transcription factor 23 2 2
MIRT593649 Stx3 syntaxin 3 2 2
MIRT593653 Ssbp3 single-stranded DNA binding protein 3 2 2
MIRT593658 Spen SPEN homolog, transcriptional regulator (Drosophila) 2 2
MIRT593668 Smarcc1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 2 2
MIRT593670 Slc7a12 solute carrier family 7 (cationic amino acid transporter, y+ system), member 12 2 2
MIRT593677 Slc1a3 solute carrier family 1 (glial high affinity glutamate transporter), member 3 2 2
MIRT593685 Sco1 SCO1 cytochrome c oxidase assembly protein 2 2
MIRT593700 Rspry1 ring finger and SPRY domain containing 1 2 2
MIRT593705 Rprd1b regulation of nuclear pre-mRNA domain containing 1B 2 2
MIRT593715 Pum2 pumilio RNA-binding family member 2 2 2
MIRT593720 Prokr2 prokineticin receptor 2 2 2
MIRT593721 Prkd3 protein kinase D3 2 2
MIRT593733 Ppih peptidyl prolyl isomerase H 2 2
MIRT593738 Pou2f2 POU domain, class 2, transcription factor 2 2 2
MIRT593739 Pld5 phospholipase D family, member 5 2 2
MIRT593748 Pgm2l1 phosphoglucomutase 2-like 1 2 2
MIRT593755 Pdzd2 PDZ domain containing 2 2 2
MIRT593761 Pax2 paired box 2 2 2
MIRT593769 Nuak2 NUAK family, SNF1-like kinase, 2 2 2
MIRT593777 Nfic nuclear factor I/C 2 2
MIRT593781 Ndor1 NADPH dependent diflavin oxidoreductase 1 2 2
MIRT593789 Nanos1 nanos homolog 1 (Drosophila) 2 2
MIRT593791 Mthfd2 methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase 2 2
MIRT593792 Ms4a6b membrane-spanning 4-domains, subfamily A, member 6B 2 2
MIRT593812 Lsm11 U7 snRNP-specific Sm-like protein LSM11 2 2
MIRT593814 Lrrc8e leucine rich repeat containing 8 family, member E 2 2
MIRT593817 Lpl lipoprotein lipase 2 2
MIRT593820 Limd1 LIM domains containing 1 2 2
MIRT593822 Lig4 ligase IV, DNA, ATP-dependent 2 2
MIRT593827 Klk9 kallikrein related-peptidase 9 2 2
MIRT593828 Klhl31 kelch-like 31 2 2
MIRT593837 Kdsr 3-ketodihydrosphingosine reductase 2 2
MIRT593839 Kdm5a lysine (K)-specific demethylase 5A 2 2
MIRT593840 Kcnj15 potassium inwardly-rectifying channel, subfamily J, member 15 2 2
MIRT593851 Hcn1 hyperpolarization-activated, cyclic nucleotide-gated K+ 1 2 2
MIRT593861 Gm15455 predicted gene 15455 2 2
MIRT593863 Trabd2b TraB domain containing 2B 1 1
MIRT593864 Glul glutamate-ammonia ligase (glutamine synthetase) 2 2
MIRT593872 Gabra1 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 2 2
MIRT593876 Fyn Fyn proto-oncogene 2 2
MIRT593880 Fam178a SMC5-SMC6 complex localization factor 2 2 2
MIRT593883 Fam172a family with sequence similarity 172, member A 2 2
MIRT593896 Edaradd EDAR (ectodysplasin-A receptor)-associated death domain 2 2
MIRT593901 Dlgap4 discs, large homolog-associated protein 4 (Drosophila) 2 2
MIRT593904 Dcaf6 DDB1 and CUL4 associated factor 6 2 2
MIRT593916 D630003M21Rik RIKEN cDNA D630003M21 gene 2 2
MIRT593920 D16Ertd472e DNA segment, Chr 16, ERATO Doi 472, expressed 2 2
MIRT593934 Cybb cytochrome b-245, beta polypeptide 2 2
MIRT593957 Cox10 cytochrome c oxidase assembly protein 10 2 2
MIRT593959 Col4a1 collagen, type IV, alpha 1 2 2
MIRT593965 Clpb ClpB caseinolytic peptidase B 2 2
MIRT593969 Cdh4 cadherin 4 2 2
MIRT593974 Cdc14b CDC14 cell division cycle 14B 2 2
MIRT593978 Car8 carbonic anhydrase 8 2 2
MIRT593979 Camkk2 calcium/calmodulin-dependent protein kinase kinase 2, beta 2 2
MIRT593980 C230081A13Rik pseudopodium-enriched atypical kinase 1 2 2
MIRT593983 Bmp2 bone morphogenetic protein 2 2 2
MIRT593986 Bet1l Bet1 golgi vesicular membrane trafficking protein like 2 2
MIRT593987 Bean1 brain expressed, associated with Nedd4, 1 2 2
MIRT594003 Fam211b leucine rich repeat containing 75B 1 1
MIRT594004 Adrb1 adrenergic receptor, beta 1 2 2
MIRT594005 Acot2 acyl-CoA thioesterase 2 2 2
MIRT594014 Ifitm10 interferon induced transmembrane protein 10 1 1
MIRT594043 1810041L15Rik RIKEN cDNA 1810041L15 gene 2 2
MIRT594046 1200014J11Rik nuclear cap binding subunit 3 2 2
MIRT594056 Zfhx3 zinc finger homeobox 3 2 2
MIRT594069 Trio triple functional domain (PTPRF interacting) 2 2
MIRT594087 Rnf11 ring finger protein 11 2 2
MIRT594090 Pdik1l PDLIM1 interacting kinase 1 like 2 2
MIRT594091 Nid1 nidogen 1 2 2
MIRT594102 Mgll monoglyceride lipase 2 2
MIRT594110 Hoxc10 homeobox C10 2 2
MIRT594112 Hoxb3 homeobox B3 2 2
MIRT594114 Hjurp Holliday junction recognition protein 2 2
MIRT594118 Foxq1 forkhead box Q1 2 2
MIRT594122 Fam63b MINDY lysine 48 deubiquitinase 2 2 2
MIRT594123 Dst dystonin 2 2
MIRT594133 Ctdspl2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 2 2
MIRT594142 Chst1 carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 2 2
MIRT594145 Ccnd1 cyclin D1 2 2
MIRT594147 Casz1 castor zinc finger 1 2 2
MIRT594162 Epb4.1l5 erythrocyte membrane protein band 4.1 like 5 2 2
MIRT594165 Cep97 centrosomal protein 97 2 2
MIRT594169 Vdr vitamin D (1,25-dihydroxyvitamin D3) receptor 2 2
MIRT594184 Irak1 interleukin-1 receptor-associated kinase 1 2 2
MIRT594190 Zic4 zinc finger protein of the cerebellum 4 2 2
MIRT594194 Zfp641 zinc finger protein 641 2 2
MIRT594200 Zfp120 zinc finger protein 120 2 2
MIRT594210 Uhrf1bp1l UHRF1 (ICBP90) binding protein 1-like 2 2
MIRT594215 Ube2k ubiquitin-conjugating enzyme E2K 2 2
MIRT594220 Trove2 TROVE domain family, member 2 2 2
MIRT594224 Tpp1 tripeptidyl peptidase I 2 2
MIRT594229 Tm9sf4 transmembrane 9 superfamily protein member 4 2 2
MIRT594236 Tfb2m transcription factor B2, mitochondrial 2 2
MIRT594248 Sorcs3 sortilin-related VPS10 domain containing receptor 3 2 2
MIRT594277 Ptprj protein tyrosine phosphatase, receptor type, J 2 2
MIRT594278 Ptges3 prostaglandin E synthase 3 2 2
MIRT594282 Prf1 perforin 1 (pore forming protein) 2 2
MIRT594286 Pphln1 periphilin 1 2 2
MIRT594289 Ppara peroxisome proliferator activated receptor alpha 2 2
MIRT594291 Pms2 PMS1 homolog2, mismatch repair system component 2 2
MIRT594293 Pmepa1 prostate transmembrane protein, androgen induced 1 2 2
MIRT594302 Opcml opioid binding protein/cell adhesion molecule-like 2 2
MIRT594305 Ocrl OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT594309 Nr3c1 nuclear receptor subfamily 3, group C, member 1 2 2
MIRT594316 Nr2c1 nuclear receptor subfamily 2, group C, member 1 2 2
MIRT594319 Nos3 nitric oxide synthase 3, endothelial cell 2 2
MIRT594327 Nav1 neuron navigator 1 2 2
MIRT594349 Mak male germ cell-associated kinase 2 2
MIRT594351 Lrrc58 leucine rich repeat containing 58 2 2
MIRT594368 Kif21a kinesin family member 21A 2 2
MIRT594371 Kcnc3 potassium voltage gated channel, Shaw-related subfamily, member 3 2 2
MIRT594376 Jkamp JNK1/MAPK8-associated membrane protein 2 2
MIRT594381 Isg15 ISG15 ubiquitin-like modifier 2 2
MIRT594400 Ing5 inhibitor of growth family, member 5 2 2
MIRT594405 Hs6st2 heparan sulfate 6-O-sulfotransferase 2 2 2
MIRT594411 Hao1 hydroxyacid oxidase 1, liver 2 2
MIRT594419 Gjd4 gap junction protein, delta 4 2 2
MIRT594421 Gdf3 growth differentiation factor 3 2 2
MIRT594445 Fam161b family with sequence similarity 161, member B 2 2
MIRT594450 Amer2 APC membrane recruitment 2 1 1
MIRT594458 Ern2 endoplasmic reticulum (ER) to nucleus signalling 2 2 2
MIRT594474 Mb21d1 Mab-21 domain containing 1 1 1
MIRT594475 Dpy19l1 dpy-19-like 1 (C. elegans) 2 2
MIRT594481 Diexf digestive organ expansion factor homolog (zebrafish) 2 2
MIRT594489 Dcx doublecortin 2 2
MIRT594491 Cspg4 chondroitin sulfate proteoglycan 4 2 2
MIRT594502 Clcn3 chloride channel, voltage-sensitive 3 2 2
MIRT594506 Cdadc1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT594512 Ccdc71 coiled-coil domain containing 71 2 2
MIRT594515 Ccdc11 cilia and flagella associated protein 53 2 2
MIRT594527 BC003965 cDNA sequence BC003965 2 2
MIRT594529 BC003331 cDNA sequence BC003331 2 2
MIRT594531 B3galt1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 2 2
MIRT594534 Auts2 autism susceptibility candidate 2 2 2
MIRT594537 Atxn3 ataxin 3 2 2
MIRT594553 Angel2 angel homolog 2 2 2
MIRT594561 Nyap2 neuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2 1 1
MIRT594562 Soga3 SOGA family member 3 1 1
MIRT594564 4931406P16Rik RIKEN cDNA 4931406P16 gene 2 2
MIRT594572 1600029D21Rik placenta expressed transcript 1 2 2
MIRT594579 Znrf1 zinc and ring finger 1 2 2
MIRT594580 Zmat3 zinc finger matrin type 3 2 2
MIRT594590 Tectb tectorin beta 2 2
MIRT594609 Pak6 p21 protein (Cdc42/Rac)-activated kinase 6 2 2
MIRT594612 Ncoa1 nuclear receptor coactivator 1 2 2
MIRT594655 Lmna lamin A 2 2
MIRT594656 Itgb4 integrin beta 4 2 2
MIRT594659 Ikzf1 IKAROS family zinc finger 1 2 2
MIRT594663 Hars histidyl-tRNA synthetase 2 2
MIRT594665 Fnip1 folliculin interacting protein 1 2 2
MIRT594681 Celf2 CUGBP, Elav-like family member 2 2 2
MIRT594687 Bicd1 bicaudal D homolog 1 (Drosophila) 2 2
MIRT594695 Asxl2 additional sex combs like 2 (Drosophila) 2 2
MIRT594699 Apbb2 amyloid beta (A4) precursor protein-binding, family B, member 2 2 2
MIRT594707 Ammecr1l AMME chromosomal region gene 1-like 2 2
MIRT594731 Zfp871 zinc finger protein 871 2 2
MIRT594743 Zfp263 zinc finger protein 263 2 2
MIRT594760 Tspyl5 testis-specific protein, Y-encoded-like 5 2 2
MIRT594765 Tmpo thymopoietin 2 2
MIRT594783 Srrm1 serine/arginine repetitive matrix 1 2 2
MIRT594793 Slc16a6 solute carrier family 16 (monocarboxylic acid transporters), member 6 2 2
MIRT594800 Sel1l sel-1 suppressor of lin-12-like (C. elegans) 2 2
MIRT594826 Pds5b PDS5 cohesin associated factor B 2 2
MIRT594830 Parp3 poly (ADP-ribose) polymerase family, member 3 2 2
MIRT594831 Pacsin1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT594834 Osbp oxysterol binding protein 2 2
MIRT594845 Npm3 nucleoplasmin 3 2 2
MIRT594861 Naaa N-acylethanolamine acid amidase 2 2
MIRT594886 Kcnma1 potassium large conductance calcium-activated channel, subfamily M, alpha member 1 2 2
MIRT594888 Irg1 aconitate decarboxylase 1 2 2
MIRT594890 Ildr2 immunoglobulin-like domain containing receptor 2 2 2
MIRT594904 Homer1 homer scaffolding protein 1 2 2
MIRT594908 Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 2 2
MIRT594928 Gm13611 60S ribosomal protein L36 pseudogene 2 2
MIRT594938 Foxp1 forkhead box P1 2 2
MIRT594978 Enpp3 ectonucleotide pyrophosphatase/phosphodiesterase 3 2 2
MIRT594986 Dtna dystrobrevin alpha 2 2
MIRT594992 Dapk1 death associated protein kinase 1 2 2
MIRT595005 Csnk1g1 casein kinase 1, gamma 1 2 2
MIRT595011 Cpox coproporphyrinogen oxidase 2 2
MIRT595018 Col8a1 collagen, type VIII, alpha 1 2 2
MIRT595027 Cflar CASP8 and FADD-like apoptosis regulator 2 2
MIRT595051 Bace1 beta-site APP cleaving enzyme 1 2 4
MIRT595111 Sgms1 sphingomyelin synthase 1 2 2
MIRT595133 Lrrc4c leucine rich repeat containing 4C 2 2
MIRT595135 Lpin1 lipin 1 2 2
MIRT595138 Itgb6 integrin beta 6 2 2
MIRT595150 Dusp10 dual specificity phosphatase 10 2 2
MIRT595157 Chic1 cysteine-rich hydrophobic domain 1 2 2
MIRT595162 Bcl11b B cell leukemia/lymphoma 11B 2 2
MIRT595163 Bach2 BTB and CNC homology, basic leucine zipper transcription factor 2 2 2
MIRT595188 Tnpo3 transportin 3 2 2
MIRT595277 Map1a microtubule-associated protein 1 A 1 1
MIRT595397 Atg10 autophagy related 10 2 4
MIRT595481 Rnf152 ring finger protein 152 2 2
MIRT595482 Rell1 RELT-like 1 2 2
MIRT595544 Cnih4 cornichon family AMPA receptor auxiliary protein 4 2 2
MIRT595560 Sstr1 somatostatin receptor 1 2 2
MIRT595583 Cr2 complement receptor 2 2 2
MIRT595696 Krt24 keratin 24 2 2
MIRT595760 P4ha1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide 2 2
MIRT595782 Hoxb1 homeobox B1 2 2
MIRT595799 Cp ceruloplasmin 2 2
MIRT595859 Phactr3 phosphatase and actin regulator 3 2 2
MIRT595910 Plekhm3 pleckstrin homology domain containing, family M, member 3 2 2
MIRT595923 Fbxl18 F-box and leucine-rich repeat protein 18 2 2
MIRT595926 E2f2 E2F transcription factor 2 2 2
MIRT595951 Slco3a1 solute carrier organic anion transporter family, member 3a1 2 2
MIRT596014 Cdk13 cyclin-dependent kinase 13 2 2
MIRT596105 Slamf1 signaling lymphocytic activation molecule family member 1 2 2
MIRT596120 Rnf170 ring finger protein 170 2 2
MIRT596126 Rhoj ras homolog family member J 2 2
MIRT596150 Peg3 paternally expressed 3 2 2
MIRT596173 Mrpl19 mitochondrial ribosomal protein L19 2 2
MIRT596192 Itga9 integrin alpha 9 2 2
MIRT596415 Lpp LIM domain containing preferred translocation partner in lipoma 2 2
MIRT596441 Nrxn1 neurexin I 2 2
MIRT596498 Zfp935 zinc finger protein 935 2 2
MIRT596936 Tnrc6a trinucleotide repeat containing 6a 2 2
MIRT596987 Tmcc3 transmembrane and coiled coil domains 3 2 2
MIRT599313 Csf1 colony stimulating factor 1 (macrophage) 2 2
MIRT599504 Ccdc32 coiled-coil domain containing 32 2 2
MIRT599684 Arl16 ADP-ribosylation factor-like 16 2 2
MIRT600164 Zadh2 zinc binding alcohol dehydrogenase, domain containing 2 2 2
MIRT600962 Dusp8 dual specificity phosphatase 8 2 2
MIRT601200 Arid3a AT rich interactive domain 3A (BRIGHT-like) 2 2
MIRT606138 Tmppe transmembrane protein with metallophosphoesterase domain 2 2
MIRT606401 Gm5494 exocrine gland secreted peptide 6 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-129 Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-129 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-129 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 up-regulated
miR-129-5p Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-129-5p Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-129-5p Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR thyroid cancer cells 21946411 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-129-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer tissue and cell line (HCT-116)
mmu-miR-129-5p Decitabine 451668 approved sensitive Low Gastric Cancer tissue and cell line (SGC7901)
mmu-miR-129-5p Doxorubicin 31703 NSC123127 approved sensitive Low Gastric Cancer tissue and cell line (SGC7901)
mmu-miR-129-5p Vincristine 5978 approved sensitive Low Gastric Cancer tissue and cell line (SGC7901)

Error report submission