miRTarBase - #MIRT577576


—
pre-miRNA Information
pre-miRNA mmu-mir-466d   
Genomic Coordinates chr2: 10511967 - 10512062
Description Mus musculus miR-466d stem-loop
Comment miR-466d-3p reported in has an additional 3' U base which is inconsistent with the current genome sequence (as shown here).
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-466d-3p
Sequence 51| UAUACAUACACGCACACAUAG |71
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Tctn3   
Synonyms 4930521E07Rik, AI197391, Tect3
Description tectonic family member 3
Transcript NM_026260   
Expression
Putative miRNA Targets on Tctn3
3'UTR of Tctn3
(miRNA target sites are highlighted)		 
>Tctn3|NM_026260|3'UTR
   1 AGAAAGAAAAGAATCCGGTTTCATTTTTCCCTATGGGAAACAAAGACAGCCTACTTATCTTGGCTAAATAGGTCCTCATG
  81 ATTACTCATGATTATAGGAGGGAATTTAGGGAAACAGGACCTAACGAAAAGGAATTTTTTTCTTTCCATTTTCTCACTAT
 161 GTCGTCTTGGTTGGCCTAGAACTCCCAATGTAGACCAGGCTGGTCTCAGGCGCACAGAGATTTTCCCCTTTGCCTCTGCC
 241 TCCAGAGTGCTGGATTAAAGGCACGTGCTATCACGCCCAGCCAGGAATCTTTATGAACTGAAGATGGTACGCTAGAAAAG
 321 TGACTACAAGTATTCCATCTTCATAGCTCTCCTCTTGGGGGGCTCCTCGGACCTCCAGATACACACTGGGTTCTCTGCGT
 401 CTAAAGCTGGGCAGGCCAAGAGCCCCCATCTCTTCAGGTTGTGTTTGCCAGGATCTCATAGGCGCATGCTCCTGCATCAT
 481 CCAGAGTGAACTCAGAGAGGCTGGCCCCTGCATTAGTGCTGACAATTCAAGCCGGGAAACTGCTGGCTCTGTGTTTTGTC
 561 TGGCTCTTTTGCCAAAGTTATAGCCACACCCTTTACCCAGACCTGAGTTAGAAAAGTAGTTCTTTCTACTCGTTTCCCAA
 641 AGTGAATGGCGTCCTATGTCCTTTTCTCACTAGCAAATGACTCCACCAGTCCTTTCTGTCCTCCCCTACTTTGTGGTGTG
 721 GTGTAATAGAAGTGACTGAGAGCTCTCTTCTGTTATGTCCAGTAGCGTGGCAGAAGTTGACACCTCATGATAGACACCCT
 801 GAGGATTTTTATGTATATGAGGTTTAAAGGGGAACTGGGACTCTCATAAACTGTATTTGAATCAGGAAAAAAAAAAAAAA
 881 AAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gauACACACGCACAUACAUAu 5'
             || |  : | ||||||| 
Target 5' cccTGAGGATTTTTATGTATa 3'
 797 - 817 146.00 -5.04
2 
miRNA  3' gaUACAC--A-CGCA-CAUACAuau 5'
            | |||  | ||||  |||||   
Target 5' caAAGTGAATGGCGTCCTATGTcct 3'
 638 - 662 113.00 -7.82
3 
miRNA  3' gauACACACGCACA-UACAUau 5'
             | |||| |||| :||||  
Target 5' tacTTTGTG-GTGTGGTGTAat 3'
 707 - 727 101.00 -15.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
CLIP-seq Support 1 for dataset GSM1385342
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_GM_Ago2_CLIP-Seq_myoblast
Location of target site NM_026260 | 3UTR | GGAUUUUUAUGUAUAUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1385343
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_DM_Ago2_CLIP-Seq_myotubes
Location of target site NM_026260 | 3UTR | GGAUUUUUAUGUAUAUGAGGUUUAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
188 mmu-miR-466d-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053139 Dcx doublecortin 1 1
MIRT053142 Pafah1b1 platelet-activating factor acetylhydrolase, isoform 1b, subunit 1 1 1
MIRT577221 Zfp963 zinc finger protein 963 2 6
MIRT577290 Zfp446 zinc finger protein 446 2 2
MIRT577553 Tdrd1 tudor domain containing 1 2 6
MIRT577576 Tctn3 tectonic family member 3 2 2
MIRT577704 Slc28a3 solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 2 2
MIRT577719 Slc22a15 solute carrier family 22 (organic anion/cation transporter), member 15 2 2
MIRT577762 Serpinb10 serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10 1 1
MIRT577861 Rassf5 Ras association (RalGDS/AF-6) domain family member 5 2 2
MIRT577924 Prl5a1 prolactin family 5, subfamily a, member 1 2 2
MIRT577973 Pira2 paired-Ig-like receptor A2 2 2
MIRT577985 Pira1 paired-Ig-like receptor A1 2 2
MIRT578459 Ints12 integrator complex subunit 12 2 2
MIRT578575 Hist1h1d histone cluster 1, H1d 2 2
MIRT578608 Haus2 HAUS augmin-like complex, subunit 2 2 2
MIRT578667 Gramd1c GRAM domain containing 1C 2 2
MIRT578691 Golt1a golgi transport 1A 2 2
MIRT578833 Fech ferrochelatase 2 2
MIRT578858 Mtfr2 mitochondrial fission regulator 2 1 3
MIRT578899 Erich1 glutamate rich 1 2 2
MIRT579229 Ccdc138 coiled-coil domain containing 138 2 2
MIRT579237 Casp8 caspase 8 2 2
MIRT579262 Bub1 BUB1, mitotic checkpoint serine/threonine kinase 2 2
MIRT579332 Atf7 activating transcription factor 7 2 2
MIRT579463 Acot11 acyl-CoA thioesterase 11 2 4
MIRT579503 A630001G21Rik RIKEN cDNA A630001G21 gene 2 2
MIRT579551 Tmem241 transmembrane protein 241 1 1
MIRT579626 Mettl20 electron transfer flavoprotein beta subunit lysine methyltransferase 1 1
MIRT579751 Zfp608 zinc finger protein 608 2 2
MIRT579919 Zbtb39 zinc finger and BTB domain containing 39 2 2
MIRT580180 Twist2 twist basic helix-loop-helix transcription factor 2 2 2
MIRT580205 Ttc7 tetratricopeptide repeat domain 7 2 2
MIRT580220 Tspan12 tetraspanin 12 2 2
MIRT580286 Trhr thyrotropin releasing hormone receptor 2 2
MIRT580314 Tnrc6b trinucleotide repeat containing 6b 2 2
MIRT580391 Slc35g1 solute carrier family 35, member G1 1 1
MIRT580404 Tmem167 transmembrane protein 167 2 2
MIRT580418 Tmem161b transmembrane protein 161B 2 2
MIRT580479 Tigd5 tigger transposable element derived 5 2 2
MIRT580508 Tet3 tet methylcytosine dioxygenase 3 2 2
MIRT580646 Stxbp6 syntaxin binding protein 6 (amisyn) 2 4
MIRT580699 Stard8 START domain containing 8 2 2
MIRT580756 Spry1 sprouty homolog 1 (Drosophila) 2 2
MIRT580817 Snx27 sorting nexin family member 27 2 2
MIRT580861 Slc8a1 solute carrier family 8 (sodium/calcium exchanger), member 1 2 2
MIRT580875 Slc7a11 solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 2 2
MIRT581025 Sipa1l1 signal-induced proliferation-associated 1 like 1 2 2
MIRT581106 Sept8 septin 8 2 2
MIRT581123 Sept3 septin 3 2 2
MIRT581204 Satb2 special AT-rich sequence binding protein 2 2 2
MIRT581408 Rbm47 RNA binding motif protein 47 2 4
MIRT581499 Pvrl4 nectin cell adhesion molecule 4 2 2
MIRT581509 Ptpro protein tyrosine phosphatase, receptor type, O 2 2
MIRT581549 Ptdss1 phosphatidylserine synthase 1 2 2
MIRT581614 Prkcd protein kinase C, delta 2 2
MIRT581624 Prkca protein kinase C, alpha 2 2
MIRT581698 Ppm1k protein phosphatase 1K (PP2C domain containing) 2 2
MIRT581726 Pofut1 protein O-fucosyltransferase 1 2 2
MIRT581759 Plxna1 plexin A1 2 2
MIRT581811 Plag1 pleiomorphic adenoma gene 1 2 2
MIRT581839 Piwil2 piwi-like RNA-mediated gene silencing 2 2 2
MIRT581873 Pik3ca phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha 2 2
MIRT581886 Pias1 protein inhibitor of activated STAT 1 2 2
MIRT581927 Pgm2l1 phosphoglucomutase 2-like 1 2 2
MIRT581978 Pcsk5 proprotein convertase subtilisin/kexin type 5 2 2
MIRT582091 Ogdh oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) 2 2
MIRT582159 Nln neurolysin (metallopeptidase M3 family) 2 2
MIRT582193 Nfkbia nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha 2 2
MIRT582309 Nacc2 nucleus accumbens associated 2, BEN and BTB (POZ) domain containing 2 8
MIRT582537 Mapk1 mitogen-activated protein kinase 1 2 2
MIRT582687 Lhfpl4 lipoma HMGIC fusion partner-like protein 4 2 6
MIRT582902 Il3 interleukin 3 2 2
MIRT582927 Il15ra interleukin 15 receptor, alpha chain 2 2
MIRT582945 Ikzf5 IKAROS family zinc finger 5 2 2
MIRT583008 Iars2 isoleucine-tRNA synthetase 2, mitochondrial 2 2
MIRT583030 Htt huntingtin 2 2
MIRT583119 Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 2 2
MIRT583213 Gpr123 adhesion G protein-coupled receptor A1 2 6
MIRT583301 Glra2 glycine receptor, alpha 2 subunit 2 2
MIRT583334 Paxbp1 PAX3 and PAX7 binding protein 1 1 3
MIRT583374 Gabra2 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 2 2 2
MIRT583405 Fzd3 frizzled class receptor 3 2 2
MIRT583536 Fbxo45 F-box protein 45 2 2
MIRT583600 Fam63b MINDY lysine 48 deubiquitinase 2 2 2
MIRT583633 Tmem236 transmembrane protein 236 1 1
MIRT583976 Dennd4a DENN/MADD domain containing 4A 2 2
MIRT584002 Dcdc2a doublecortin domain containing 2a 2 2
MIRT584047 Cysltr1 cysteinyl leukotriene receptor 1 2 2
MIRT584094 Csrnp3 cysteine-serine-rich nuclear protein 3 2 2
MIRT584303 Chic1 cysteine-rich hydrophobic domain 1 2 2
MIRT584317 Chek1 checkpoint kinase 1 2 6
MIRT584368 Cdk19 cyclin-dependent kinase 19 2 2
MIRT584723 Atp8b1 ATPase, class I, type 8B, member 1 2 2
MIRT584783 Arl8a ADP-ribosylation factor-like 8A 2 2
MIRT584803 Arl15 ADP-ribosylation factor-like 15 2 2
MIRT584830 Arhgef33 Rho guanine nucleotide exchange factor (GEF) 33 2 2
MIRT584908 Alg6 asparagine-linked glycosylation 6 (alpha-1,3,-glucosyltransferase) 2 2
MIRT584954 Adamts4 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4 2 6
MIRT585035 Lrrc71 leucine rich repeat containing 71 1 1
MIRT585055 Pcnxl4 pecanex homolog 4 1 1
MIRT585102 Zfp941 zinc finger protein 941 2 2
MIRT585155 Zfp874b zinc finger protein 874b 2 2
MIRT585341 Ybey ybeY metallopeptidase 2 2
MIRT585395 Wfdc12 WAP four-disulfide core domain 12 2 2
MIRT585481 Txlnb taxilin beta 2 2
MIRT585517 Trp53rk transformation related protein 53 regulating kinase B 2 2
MIRT585551 Tpte transmembrane phosphatase with tensin homology 2 2
MIRT585705 Tbc1d24 TBC1 domain family, member 24 2 2
MIRT585745 Stat1 signal transducer and activator of transcription 1 2 2
MIRT585891 Slc1a7 solute carrier family 1 (glutamate transporter), member 7 2 2
MIRT585920 Slc16a9 solute carrier family 16 (monocarboxylic acid transporters), member 9 2 2
MIRT586028 Sass6 SAS-6 centriolar assembly protein 2 4
MIRT586037 Rsad1 radical S-adenosyl methionine domain containing 1 2 2
MIRT586138 Rbm41 RNA binding motif protein 41 2 2
MIRT586187 Ptprr protein tyrosine phosphatase, receptor type, R 2 2
MIRT586346 Pdxk pyridoxal (pyridoxine, vitamin B6) kinase 2 2
MIRT586393 Padi2 peptidyl arginine deiminase, type II 2 4
MIRT586425 Oip5 Opa interacting protein 5 2 2
MIRT586505 Neu4 sialidase 4 2 2
MIRT586628 Mfsd2b major facilitator superfamily domain containing 2B 2 2
MIRT586672 Mbd4 methyl-CpG binding domain protein 4 2 2
MIRT586951 Gstt3 glutathione S-transferase, theta 3 2 2
MIRT587232 Nxpe3 neurexophilin and PC-esterase domain family, member 3 1 1
MIRT587547 Cxcl5 chemokine (C-X-C motif) ligand 5 2 2
MIRT587737 Cd28 CD28 antigen 2 2
MIRT587784 Ccpg1 cell cycle progression 1 2 2
MIRT587900 BC003965 cDNA sequence BC003965 2 2
MIRT588022 Akap7 A kinase (PRKA) anchor protein 7 2 2
MIRT588062 Fam211b leucine rich repeat containing 75B 1 1
MIRT588076 AI429214 expressed sequence AI429214 2 2
MIRT588152 Ccdc169 coiled-coil domain containing 169 1 1
MIRT588369 Zfp462 zinc finger protein 462 2 2
MIRT588434 Ythdc2 YTH domain containing 2 2 2
MIRT588492 Wbp4 WW domain binding protein 4 2 2
MIRT588514 Uty ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome 2 2
MIRT588608 Tsc22d3 TSC22 domain family, member 3 2 2
MIRT588653 Tmem200a transmembrane protein 200A 2 2
MIRT588746 Synj2bp synaptojanin 2 binding protein 2 2
MIRT588776 Strbp spermatid perinuclear RNA binding protein 2 2
MIRT588793 Ss18l1 SS18, nBAF chromatin remodeling complex subunit like 1 2 6
MIRT588815 Srgap3 SLIT-ROBO Rho GTPase activating protein 3 2 2
MIRT588840 Sort1 sortilin 1 2 2
MIRT588960 Scn2a1 sodium channel, voltage-gated, type II, alpha 2 2
MIRT589071 Rbbp9 retinoblastoma binding protein 9, serine hydrolase 2 2
MIRT589079 Rbbp5 retinoblastoma binding protein 5, histone lysine methyltransferase complex subunit 2 2
MIRT589086 Rasal2 RAS protein activator like 2 2 2
MIRT589115 Rasa2 RAS p21 protein activator 2 2 2
MIRT589122 Rai1 retinoic acid induced 1 2 2
MIRT589140 Rad51d RAD51 paralog D 1 1
MIRT589278 Pitpnb phosphatidylinositol transfer protein, beta 2 2
MIRT589407 Nrf1 nuclear respiratory factor 1 2 2
MIRT589458 Nceh1 neutral cholesterol ester hydrolase 1 2 2
MIRT589509 Mtf1 metal response element binding transcription factor 1 2 2
MIRT589635 Loxl3 lysyl oxidase-like 3 2 2
MIRT589761 Iws1 IWS1, SUPT6 interacting protein 2 2
MIRT589897 Gtpbp2 GTP binding protein 2 2 2
MIRT589944 Gfod1 glucose-fructose oxidoreductase domain containing 1 2 2
MIRT590057 Fbxl17 F-box and leucine-rich repeat protein 17 2 4
MIRT590130 Ephb3 Eph receptor B3 2 2
MIRT590408 Ccna2 cyclin A2 2 2
MIRT590435 Casz1 castor zinc finger 1 2 2
MIRT590463 Car5b carbonic anhydrase 5b, mitochondrial 2 2
MIRT590477 Camsap2 calmodulin regulated spectrin-associated protein family, member 2 1 1
MIRT590511 Bsn bassoon 2 6
MIRT590568 B3gnt2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 2
MIRT590730 Ado 2-aminoethanethiol (cysteamine) dioxygenase 2 2
MIRT590812 1110059G10Rik RIKEN cDNA 1110059G10 gene 2 2
MIRT591120 Oas3 2'-5' oligoadenylate synthetase 3 2 2
MIRT591371 E2f1 E2F transcription factor 1 2 2
MIRT592052 Tbc1d13 TBC1 domain family, member 13 2 2
MIRT592234 Ly96 lymphocyte antigen 96 2 2
MIRT592723 Fbxl14 F-box and leucine-rich repeat protein 14 2 6
MIRT592776 Diap2 diaphanous related formin 2 2 6
MIRT593255 Tas1r3 taste receptor, type 1, member 3 2 2
MIRT594457 Evi2b ecotropic viral integration site 2b 2 2
MIRT594617 Myt1l myelin transcription factor 1-like 2 2
MIRT594671 Ehf ets homologous factor 2 2
MIRT594752 Wdr89 WD repeat domain 89 2 2
MIRT595408 Arid2 AT rich interactive domain 2 (ARID, RFX-like) 2 2
MIRT595642 Abi3bp ABI gene family, member 3 (NESH) binding protein 2 2
MIRT603343 Slc16a10 solute carrier family 16 (monocarboxylic acid transporters), member 10 2 2
MIRT604328 Bpifc BPI fold containing family C 2 2
MIRT604501 2510049J12Rik makorin, ring finger protein 2, opposite strand 2 2
MIRT604865 Mef2a myocyte enhancer factor 2A 2 2
MIRT605402 Tacr2 tachykinin receptor 2 2 2
MIRT605871 Atpbd4 diphthamine biosynthesis 6 2 2
MIRT606107 Unc5c unc-5 netrin receptor C 2 2

Error report submission