pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-186 |
Genomic Coordinates | chr3: 157544279 - 157544349 |
Synonyms | Mirn186, mmu-mir-186, Mir186 |
Description | Mus musculus miR-186 stem-loop |
Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
RNA Secondary Structure |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-186-5p |
Sequence | 7| CAAAGAAUUCUCCUUUUGGGCU |28 |
Evidence | Experimental |
Experiments | Cloned |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Qpct | ||||||||||||||||||||
Synonyms | 5730422A13Rik | ||||||||||||||||||||
Description | glutaminyl-peptide cyclotransferase (glutaminyl cyclase) | ||||||||||||||||||||
Transcript | NM_027455 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Qpct | |||||||||||||||||||||
3'UTR of Qpct (miRNA target sites are highlighted) |
>Qpct|NM_027455|3'UTR 1 TGTTTGGATTTAGTTTCTGGTAATTGCTTCTACAGCAACTTCAAGACACCATTTATACAATCTGCTTCCAGATAAATGTG 81 TGTAGACTTCTGTCCTATAGATTCATTCTGTAGGTGTTTTTGAATATGTGATCAGCGAACTGTAGAATTCTATGATGCCT 161 TCACTAATTTTCCTCTAGAGATGAGAAAGAAACATGTAAAGAAATAAAATAATAATAATTTTTAAAATTCTTTTGGATTA 241 AAACTTTAACATAAAGTTAGATTTATTTACCAATACCATAGATTTGTAAACAATACTTAGATACAATGATGCTGTATGGT 321 ATAGTGGTAGTTTTATATGTGATATTATATAGTGTGTTATATAATATGTAATAAAACACAGGCATATACTTTGACAGCCT 401 TTAAGTTTCTTTAAAAAAAGCTTTGGAAATTAAAGTCTGAATTAAATTGCATATTGTGAATTTATTTTCATGTCCATAAA 481 TGAGAAAGTGTCTGTTTTAATGCATGGTCCAGTTTTCTAGATTTTTATACCTATAATTTTTTTTTGTAAAGATGATAGAG 561 TTGGTGACAAAACCTTCAGAAAAGGATACAAAATATAATCCCATTGCATT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | C2C12 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast
HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes
... - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell. |
Article |
- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al. - Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
|
46 mmu-miR-186-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT577608 | Stxbp4 | syntaxin binding protein 4 | 1 | 1 | ||||||||
MIRT577884 | Qpct | glutaminyl-peptide cyclotransferase (glutaminyl cyclase) | 1 | 1 | ||||||||
MIRT578137 | Noc3l | NOC3 like DNA replication regulator | 1 | 1 | ||||||||
MIRT578249 | Mnat1 | menage a trois 1 | 1 | 1 | ||||||||
MIRT579147 | Ces2g | carboxylesterase 2G | 1 | 1 | ||||||||
MIRT579219 | Ccdc138 | coiled-coil domain containing 138 | 1 | 1 | ||||||||
MIRT579578 | 4933427D06Rik | RIKEN cDNA 4933427D06 gene | 1 | 1 | ||||||||
MIRT580348 | Tmem33 | transmembrane protein 33 | 1 | 1 | ||||||||
MIRT580592 | Tbl1xr1 | transducin (beta)-like 1X-linked receptor 1 | 1 | 1 | ||||||||
MIRT580668 | Stk32a | serine/threonine kinase 32A | 1 | 1 | ||||||||
MIRT580744 | Srek1 | splicing regulatory glutamine/lysine-rich protein 1 | 1 | 1 | ||||||||
MIRT580779 | Sp6 | trans-acting transcription factor 6 | 1 | 1 | ||||||||
MIRT580847 | Sltm | SAFB-like, transcription modulator | 1 | 1 | ||||||||
MIRT580944 | Slc26a5 | solute carrier family 26, member 5 | 1 | 1 | ||||||||
MIRT581214 | Samd4 | sterile alpha motif domain containing 4 | 1 | 1 | ||||||||
MIRT581276 | Rprd2 | regulation of nuclear pre-mRNA domain containing 2 | 1 | 1 | ||||||||
MIRT581520 | Ptprb | protein tyrosine phosphatase, receptor type, B | 1 | 1 | ||||||||
MIRT582203 | Nfia | nuclear factor I/A | 1 | 1 | ||||||||
MIRT582893 | Ildr2 | immunoglobulin-like domain containing receptor 2 | 1 | 1 | ||||||||
MIRT582996 | Id4 | inhibitor of DNA binding 4 | 1 | 1 | ||||||||
MIRT583079 | Hnrnpa3 | heterogeneous nuclear ribonucleoprotein A3 | 1 | 1 | ||||||||
MIRT583125 | Heca | hdc homolog, cell cycle regulator | 1 | 1 | ||||||||
MIRT583739 | Epm2aip1 | EPM2A (laforin) interacting protein 1 | 1 | 1 | ||||||||
MIRT584127 | Crispld2 | cysteine-rich secretory protein LCCL domain containing 2 | 1 | 1 | ||||||||
MIRT584166 | Cpox | coproporphyrinogen oxidase | 1 | 1 | ||||||||
MIRT584531 | C230081A13Rik | pseudopodium-enriched atypical kinase 1 | 1 | 1 | ||||||||
MIRT584646 | Bach2 | BTB and CNC homology, basic leucine zipper transcription factor 2 | 1 | 1 | ||||||||
MIRT587978 | Armc1 | armadillo repeat containing 1 | 1 | 1 | ||||||||
MIRT588832 | Sp1 | trans-acting transcription factor 1 | 1 | 2 | ||||||||
MIRT590758 | Acbd5 | acyl-Coenzyme A binding domain containing 5 | 1 | 1 | ||||||||
MIRT593146 | Mmp12 | matrix metallopeptidase 12 | 1 | 4 | ||||||||
MIRT593495 | Gjc3 | gap junction protein, gamma 3 | 1 | 1 | ||||||||
MIRT594880 | Lrig2 | leucine-rich repeats and immunoglobulin-like domains 2 | 1 | 1 | ||||||||
MIRT594898 | Ifi204 | interferon activated gene 204 | 1 | 1 | ||||||||
MIRT594932 | Gdi2 | guanosine diphosphate (GDP) dissociation inhibitor 2 | 1 | 1 | ||||||||
MIRT594945 | Fmnl2 | formin-like 2 | 1 | 1 | ||||||||
MIRT595197 | Emc3 | ER membrane protein complex subunit 3 | 1 | 1 | ||||||||
MIRT595343 | Frmd4a | FERM domain containing 4A | 1 | 1 | ||||||||
MIRT595402 | Arsk | arylsulfatase K | 1 | 1 | ||||||||
MIRT595430 | A630033H20Rik | RIKEN cDNA A630033H20 gene | 1 | 1 | ||||||||
MIRT595947 | Nelfa | negative elongation factor complex member A, Whsc2 | 1 | 1 | ||||||||
MIRT596153 | Opn5 | opsin 5 | 1 | 1 | ||||||||
MIRT601390 | Utp23 | UTP23 small subunit processome component | 1 | 1 | ||||||||
MIRT602153 | Intu | inturned planar cell polarity protein | 1 | 1 | ||||||||
MIRT602577 | Colec12 | collectin sub-family member 12 | 1 | 1 | ||||||||
MIRT604817 | Nr5a2 | nuclear receptor subfamily 5, group A, member 2 | 1 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|