miRTarBase - #MIRT578205


—
pre-miRNA Information
pre-miRNA mmu-mir-3065   
Genomic Coordinates chr11: 120014767 - 120014853
Description Mus musculus miR-3065 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-3065-5p
Sequence 14| UCAACAAAAUCACUGAUGCUGG |35
Evidence Experimental
Experiments Illumina
Putative Targets

Gene Information
Gene Symbol Naaa   
Synonyms 2210023K21Rik, 3830414F09Rik, Asahl
Description N-acylethanolamine acid amidase
Transcript NM_001163687   
Other Transcripts NM_025972   
Expression
Putative miRNA Targets on Naaa
3'UTR of Naaa
(miRNA target sites are highlighted)		 
>Naaa|NM_001163687|3'UTR
   1 AGGTGATGTATTGTCAAAAAGCTGCATTTAGAAGTCTAAGACTGGAAGGACTGTCCCGTTTCCTGAGCAACGCAGGCTCC
  81 CTCCCCACAGAGCGTTTCTGCCTGTGGAGGAAGAGGAGCGCAGCCTGCTGTCTTGGTCCTCCTGACTTCCTGGTCCCCTT
 161 GAGCTTCACTAACAGCCCACCTTGGCTTGAACAACTCATATAACTGGTCTCAGAGGTCAGGCTGCACCCAACCAGTCACA
 241 AGTGTCCTGTGATTCTGTGTTCACACTCCTGCTTGTCCACTGAAGAAGGGACAGGACAAGATGGCTGTCATGTGGACAAA
 321 CCCAGGTTTCTCCTAAGGCTGGGTGAGGCTTAGTGGCAGGGTTTGCACCGATAGATAGATAGATGATAGATAGATAGATA
 401 GATAGATAGATAGATAGATAGATAGATAGATAATAGATAGAAAGATAGATAGACAAATGAGAGTTTTCTCTGAAGAGCAG
 481 AGACCTCTAATTTGAGTAAAATTTTCTTAAAGCTATGAACTCTGACTTTTGATTTTGTGTTTCCATTTAGTAGAAACTCA
 561 TTTTTTGTAAACTTCTAATGTATTTTTTTAAATGTAAGCCTTATTAAAAATAAAACTACTTTCTTACTACTTTTGAAAAA
 641 TATATGACACCAAATAATATCCTGTCATCGTTTGTTAATAAAATGTCAAAAAAAAAAATGCTAGCTGTGAAGAGAAAACT
 721 TATAATTTTGGGTCTTATAGCATTGTGGTATCTAAGCTCAAGAAATTCAGGGCTGAAGAATAGACCCAGGCGGATCCAGG
 801 CACAGCCAGATCCACCCTGTAGCTAAGAATGTCCGGCCATAAAAGATAAAAAAGAAAGTGCAGGAACTAGCCAGGGCTAT
 881 CAGGACCAAATGGCCATCTGGCAGGATGGCGCCTCCCGGGTGGCACCTCCCTATAGCCCACCATAAATCATATACTGACC
 961 AGGTGTCCTGCTGACCTCGAGAAGTCCAAGCCTTTGTGCCCCCCTACACCTTAACTAGCATGTACTGCCCTGTTAATTTG
1041 TAATCACCTCGCCGACATTTAAATAAGCCAATCATGTGTAACCTCGCAAATTCCTTCGGCTCCCTCCCTTTTTGGTTTGT
1121 GGTTTTTGCCTTTATAAGCCTGTAAGAAGTTTGGGCCGGGGTCGAACTCCCCTGCCCCCTGCGCAGTGCATGAGTTTCGA
1201 CCCCAGCATGCTGGCTTGAGTGCTCTTTTGTTGTTTGTGTGTGTGTGTGTGTGTGTGTGTGCCATTAAAAGCCTGTTGTT
1281 ACAACG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggUCGUAGUCAC--UAAAACAACu 5'
            :|| | ||||   |||||||| 
Target 5' ctGGCTTGAGTGCTCTTTTGTTGt 3'
 1211 - 1234 162.00 -14.80
2 
miRNA  3' ggUCGUA-GUCACUA--AAACAAcu 5'
            | :|| | || ||  ||||||  
Target 5' atAATATCCTGTCATCGTTTGTTaa 3'
 654 - 678 134.00 -7.40
3 
miRNA  3' ggucguagucACUAAAACAacu 5'
                    |||||||||   
Target 5' ctctgactttTGATTTTGTgtt 3'
 520 - 541 120.00 -6.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions mESCs
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM622572. RNA binding protein: AGO2. Condition:WT2 ...

- Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology.

Article - Leung AK; Young AG; Bhutkar A; Zheng GX; et al.
- Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions CD4+ T cells (C57BL/6)
Disease MIMAT0014836
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM1013576. RNA binding protein: AGO2. Condition:CD4+ T cells ...

- Loeb GB; Khan AA; Canner D; Hiatt JB; et al., 2012, Molecular cell.

Article - Loeb GB; Khan AA; Canner D; Hiatt JB; et al.
- Molecular cell, 2012
MicroRNAs (miRNAs) are essential components of gene regulation, but identification of miRNA targets remains a major challenge. Most target prediction and discovery relies on perfect complementarity of the miRNA seed to the 3' untranslated region (UTR). However, it is unclear to what extent miRNAs target sites without seed matches. Here, we performed a transcriptome-wide identification of the endogenous targets of a single miRNA-miR-155-in a genetically controlled manner. We found that approximately 40% of miR-155-dependent Argonaute binding occurs at sites without perfect seed matches. The majority of these noncanonical sites feature extensive complementarity to the miRNA seed with one mismatch. These noncanonical sites confer regulation of gene expression, albeit less potently than canonical sites. Thus, noncanonical miRNA binding sites are widespread, often contain seed-like motifs, and can regulate gene expression, generating a continuum of targeting and regulation.
LinkOut: [PMID: 23142080]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
133 mmu-miR-3065-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT430695 Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 1 1
MIRT577276 Zfp619 zinc finger protein 619 1 1
MIRT577437 Ttyh1 tweety family member 1 1 1
MIRT577647 Sod2 superoxide dismutase 2, mitochondrial 1 1
MIRT577852 Rassf9 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 1 1
MIRT577896 Prrg4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 1 4
MIRT577952 Pole4 polymerase (DNA-directed), epsilon 4 (p12 subunit) 1 1
MIRT578007 Pgpep1 pyroglutamyl-peptidase I 1 1
MIRT578136 Noc3l NOC3 like DNA replication regulator 1 1
MIRT578205 Naaa N-acylethanolamine acid amidase 1 3
MIRT578451 Ints7 integrator complex subunit 7 1 2
MIRT578772 Gatsl2 GATS protein-like 2 1 2
MIRT578776 Gata1 GATA binding protein 1 1 1
MIRT578863 Fam163a family with sequence similarity 163, member A 1 1
MIRT578864 Fam159b family with sequence similarity 159, member B 1 1
MIRT579037 Cts8 cathepsin 8 1 1
MIRT579539 Coa5 cytochrome C oxidase assembly factor 5 1 1
MIRT579653 2010106E10Rik RIKEN cDNA 2010106E10 gene 1 1
MIRT579710 Zic1 zinc finger protein of the cerebellum 1 1 1
MIRT579721 Zfp92 zinc finger protein 92 1 2
MIRT579828 Zfp106 zinc finger protein 106 1 1
MIRT579873 Zbtb8b zinc finger and BTB domain containing 8b 1 1
MIRT579938 Zbtb34 zinc finger and BTB domain containing 34 1 1
MIRT580092 Usp54 ubiquitin specific peptidase 54 1 1
MIRT580347 Tmem33 transmembrane protein 33 1 1
MIRT580373 Tmem229a transmembrane protein 229A 1 2
MIRT580541 Tcp11l2 t-complex 11 (mouse) like 2 1 1
MIRT580657 Stxbp5l syntaxin binding protein 5-like 1 2
MIRT580728 Srrm4 serine/arginine repetitive matrix 4 1 1
MIRT580766 Spp1 secreted phosphoprotein 1 1 1
MIRT580853 Slc8a1 solute carrier family 8 (sodium/calcium exchanger), member 1 1 1
MIRT581257 Rras2 related RAS viral (r-ras) oncogene 2 1 1
MIRT581367 Rcor3 REST corepressor 3 1 1
MIRT581452 Ranbp3l RAN binding protein 3-like 1 1
MIRT581626 Prkar2a protein kinase, cAMP dependent regulatory, type II alpha 1 1
MIRT581835 Pkia protein kinase inhibitor, alpha 1 1
MIRT581897 Phc3 polyhomeotic-like 3 (Drosophila) 1 2
MIRT582138 Npr3 natriuretic peptide receptor 3 1 1
MIRT582434 Mllt3 myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3 1 1
MIRT582435 Kmt2a lysine (K)-specific methyltransferase 2A 1 1
MIRT582473 Med28 mediator complex subunit 28 1 1
MIRT582523 March1 membrane-associated ring finger (C3HC4) 1 1 2
MIRT582739 Kpna1 karyopherin (importin) alpha 1 1 1
MIRT582765 Klf12 Kruppel-like factor 12 1 1
MIRT583052 Hoxc4 homeobox C4 1 1
MIRT583070 Hnrnpul2 heterogeneous nuclear ribonucleoprotein U-like 2 1 1
MIRT583389 Fzd6 frizzled class receptor 6 1 1
MIRT583418 Fubp3 far upstream element (FUSE) binding protein 3 1 2
MIRT583486 Foxc2 forkhead box C2 1 1
MIRT583748 Ephb2 Eph receptor B2 1 1
MIRT583894 Dtna dystrobrevin alpha 1 1
MIRT583996 Dck deoxycytidine kinase 1 1
MIRT584018 Dcaf17 DDB1 and CUL4 associated factor 17 1 1
MIRT584023 Tmem245 transmembrane protein 245 1 2
MIRT584102 Csnk1e casein kinase 1, epsilon 1 1
MIRT584246 Cnnm3 cyclin M3 1 2
MIRT584385 Cdh12 cadherin 12 1 1
MIRT584396 Cdc37l1 cell division cycle 37-like 1 1 1
MIRT584462 Cbfa2t3 core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human) 1 1
MIRT584494 Camkk2 calcium/calmodulin-dependent protein kinase kinase 2, beta 1 1
MIRT584630 Bbx bobby sox HMG box containing 1 1
MIRT584793 Arl5a ADP-ribosylation factor-like 5A 1 1
MIRT584821 Arid3b AT rich interactive domain 3B (BRIGHT-like) 1 1
MIRT584838 Arhgef18 rho/rac guanine nucleotide exchange factor (GEF) 18 1 1
MIRT584952 Adamts5 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2) 1 1
MIRT585099 Zfp945 zinc finger protein 945 1 1
MIRT585623 Tnfaip6 tumor necrosis factor alpha induced protein 6 1 1
MIRT585661 Tmco1 transmembrane and coiled-coil domains 1 1 2
MIRT585936 Slc14a2 solute carrier family 14 (urea transporter), member 2 1 2
MIRT586062 Rnd1 Rho family GTPase 1 1 1
MIRT586696 Lrrtm4 leucine rich repeat transmembrane neuronal 4 1 1
MIRT586756 Kdm5d lysine (K)-specific demethylase 5D 1 1
MIRT586958 Grhl1 grainyhead-like 1 (Drosophila) 1 1
MIRT586989 Gpr107 G protein-coupled receptor 107 1 1
MIRT586997 Gpkow G patch domain and KOW motifs 1 1
MIRT587056 Gm5464 predicted gene 5464 1 1
MIRT587297 Extl1 exostoses (multiple)-like 1 1 1
MIRT587428 Dmd dystrophin, muscular dystrophy 1 1
MIRT587531 Cxxc5 CXXC finger 5 1 1
MIRT587941 Atp1b3 ATPase, Na+/K+ transporting, beta 3 polypeptide 1 1
MIRT588042 Aim2 absent in melanoma 2 1 1
MIRT588860 Smad7 SMAD family member 7 1 1
MIRT588862 Slit3 slit homolog 3 (Drosophila) 1 1
MIRT588901 Slc16a6 solute carrier family 16 (monocarboxylic acid transporters), member 6 1 1
MIRT588916 Skor1 SKI family transcriptional corepressor 1 1 1
MIRT588918 Six6 sine oculis-related homeobox 6 1 1
MIRT588969 Sall1 sal-like 1 (Drosophila) 1 1
MIRT588972 S1pr3 sphingosine-1-phosphate receptor 3 1 2
MIRT589007 Robo1 roundabout guidance receptor 1 1 1
MIRT589016 Rnf150 ring finger protein 150 1 2
MIRT589317 Pbx1 pre B cell leukemia homeobox 1 1 2
MIRT589465 Ncam1 neural cell adhesion molecule 1 1 2
MIRT589658 Lhfpl4 lipoma HMGIC fusion partner-like protein 4 1 1
MIRT589751 Jph1 junctophilin 1 1 1
MIRT589804 Id1 inhibitor of DNA binding 1 1 1
MIRT590017 Foxa1 forkhead box A1 1 1
MIRT590127 Ercc6 excision repair cross-complementing rodent repair deficiency, complementation group 6 1 1
MIRT590256 Dennd5b DENN/MADD domain containing 5B 1 1
MIRT590273 Dcun1d1 DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) 1 1
MIRT590384 Cep170 centrosomal protein 170 1 1
MIRT590678 Ankrd28 ankyrin repeat domain 28 1 1
MIRT590712 Agtr1b angiotensin II receptor, type 1b 1 1
MIRT590770 Faxc failed axon connections homolog 1 1
MIRT593316 Nudcd3 NudC domain containing 3 1 1
MIRT593331 Ddx3x DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked 1 1
MIRT594854 Ncapg2 non-SMC condensin II complex, subunit G2 1 1
MIRT595054 Ankrd29 ankyrin repeat domain 29 1 1
MIRT597158 Ston1 stonin 1 1 1
MIRT598524 Itsn1 intersectin 1 (SH3 domain protein 1A) 1 1
MIRT598732 Gucy2c guanylate cyclase 2c 1 1
MIRT599943 Rmi2 RecQ mediated genome instability 2 1 1
MIRT600798 Hmg20a high mobility group 20A 1 1
MIRT600906 Fam126b family with sequence similarity 126, member B 1 1
MIRT603234 Tlr3 toll-like receptor 3 1 1
MIRT603378 Sh2d4a SH2 domain containing 4A 1 1
MIRT604113 Dis3l DIS3 like exosome 3'-5' exoribonuclease 1 1
MIRT604271 Cd33 CD33 antigen 1 1
MIRT604719 Samd8 sterile alpha motif domain containing 8 1 1
MIRT604725 Rs1 retinoschisis (X-linked, juvenile) 1 (human) 1 1
MIRT604981 Ftsj1 FtsJ RNA methyltransferase homolog 1 (E. coli) 1 1
MIRT604997 Fgf13 fibroblast growth factor 13 1 1
MIRT605729 Gm5415 predicted gene 5415 1 1
MIRT605798 Creb3l2 cAMP responsive element binding protein 3-like 2 1 1
MIRT605930 Sertad3 SERTA domain containing 3 1 1
MIRT605934 Senp8 SUMO/sentrin specific peptidase 8 1 1
MIRT606120 Trerf1 transcriptional regulating factor 1 1 1
MIRT606209 Sdad1 SDA1 domain containing 1 1 1
MIRT606288 Nudt11 nudix (nucleoside diphosphate linked moiety X)-type motif 11 1 1
MIRT606324 Ms4a6b membrane-spanning 4-domains, subfamily A, member 6B 1 1
MIRT606376 Igf1 insulin-like growth factor 1 1 1
MIRT606464 Deptor DEP domain containing MTOR-interacting protein 1 1
MIRT606642 Nhsl2 NHS-like 2 1 1
MIRT606667 Kcnh1 potassium voltage-gated channel, subfamily H (eag-related), member 1 1 1

Error report submission