miRTarBase - #MIRT578457


—
pre-miRNA Information
pre-miRNA mmu-mir-466e   
Genomic Coordinates chr2: 10479088 - 10479171
Synonyms mmu-mir-466e, Mir466e
Description Mus musculus miR-466e stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-466e-3p
Sequence 51| UAUACAUACACGCACACAUAAGA |73
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Ints12   
Synonyms 1110020M19Rik, 2810027J24Rik, 4930529N21Rik, A230056J18Rik, AI666778, Phf22, int12
Description integrator complex subunit 12
Transcript NM_027927   
Expression
Putative miRNA Targets on Ints12
3'UTR of Ints12
(miRNA target sites are highlighted)		 
>Ints12|NM_027927|3'UTR
   1 TATGGCCAGATAGATTTTTATATCATATTACTCTAAAACTTAAAAAACAAAACAAAACAAACAAAATAAAACCCTTACTG
  81 GGACAAAAGTTGTAATGTACTGTACCTTAATAAAAATCTTGATCAAATCTCTATTGTTTGTTACATTAAAATGCTAATAT
 161 TATTTAGCCAAACTTGGATCTATTTATTTCAGTCTGTTTAGCATTTTTAATTTCCATAGTGTGTGAAAATAGTGATTATA
 241 ATGACTGATGCATGACAAGAGCTTCAAGAAATTGATGGCGCATACAGATGAAAAGAAATGGCTCACCTGGTACCTTATGG
 321 GTGGCAGGGACAACTCAATAGAAAGTGTTCCAGCGTTTTATAAAATCTGAAATGTTCAGTGTCAGTCATTGTCCTCATGT
 401 CAGCTAGTATCTCTCTCCAATTACCTCCTCTTTTATCAAAATTAATTTTGAAAGTGATTTCCCATAGCTCCCTATCATGT
 481 CTTTAGCTCTCAACCACCCCTTATCAATTACTTAGGGCGTTATTTATTCCAGTAGATTATGAATGCTCATACAGTATACT
 561 TTCTCACGTTGCCCACTTTCCGTACCTGGCCAGTGTGTGGATATGTGCAGATATGTACATTTAATAAATGCTGACTTGGC
 641 TCATCCTGGTTGCACATTCTGAGAATCATTGAGAAGAGTATCCATTTCCAAGAGGCTTGGCAGATGGGCATTTATGACTA
 721 GTTTGCACCCAGCTTCTTCCTCATGGTGAAAGGACAAGCTGTTTTTAATACTTCAAGAACGTTTGGTGTGGTTTATCTTT
 801 GTATGAAAGAGGCTCCTACCTAATGATTAGTCCTTGAGGTTTCTGTCAGAACGTGCTCATATGCTTTGAATATTGTTAGG
 881 ATATGGTTTGTCTTAAGGTTTTATGTGTTAGGAAGCATAATCCCCAATATGGCAATGGAGTTGGTGGTTGACAGGTGGAG
 961 CCTGTTGGGGGAAGAGTATGCCCTTGGGAAGGATTAATTAGTCCTCATATGTCCACTGACTAATTCTGGCCAAGAGTGGA
1041 GTTATAAAAGGCTATCCCAGAATTGACCCTTGGGCAAAATCTCCTCTGAACTCTTGCCGTGATGTGATCCTATATACATG
1121 GTCCAAGCCATTGTCTTGTAAGCTAATGAATTACCCATTAGTTTACATATATATATGTATATATGTACATACCCCAACAG
1201 AGAATACTTTCTGTATCTGACCAGTAAATGTATTATAGAAAAATAGCTTCCTTTCTTTTTTATAATCAATGAATACCTCA
1281 TTATTTCCCAAAAATGAATCTTGTGATTTCCTATATTCATTGAGTCAAATTGCTTTAAATCTAATCTCAGTGTATCTTTA
1361 TCCCTAGATGTTCTAACATCATTATTCTAAAAATAAATTGATAATCATTGTAAAAGAGAAAACTTTTAAATTAAGCTTGG
1441 TCTTTTTCTATGGAAGTATTTTAAACTGTTAAATAATGGCGTTAAATTGTTCATAATAAATTAGAAACCAATATTGAAAT
1521 AAACTCAAAATTTAGAGATGGAATAAATATCTATTTATATACTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agAAUACACACG----CACAUACAUAu 5'
            ||| || | |     | ||||||| 
Target 5' caTTA-GTTTACATATATATATGTATa 3'
 1156 - 1181 146.00 -5.50
2 
miRNA  3' agaaUACACACGCACAUACAUau 5'
              || |||||   ||||||  
Target 5' gtggATATGTGCAGATATGTAca 3'
 597 - 619 143.00 -8.20
3 
miRNA  3' agAAUACACACGCACAUACAUAu 5'
            ||| | ||   | |||||:| 
Target 5' tcTTAAG-GT---TTTATGTGTt 3'
 891 - 909 133.00 -6.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agAAUACACACGCACAUACAUAu 5'
            |||  | |   | ||||||| 
Target 5' guUUACAUAU--AUAUAUGUAUa 3'
 		1 - 21
Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
CLIP-seq Support 1 for dataset GSM1385342
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_GM_Ago2_CLIP-Seq_myoblast
Location of target site NM_027927 | 3UTR | GUUUACAUAUAUAUAUGUAUAUAUGUACAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1385343
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_DM_Ago2_CLIP-Seq_myotubes
Location of target site NM_027927 | 3UTR | GUUUACAUAUAUAUAUGUAUAUAUGUACAUACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
186 mmu-miR-466e-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT577218 Zfp963 zinc finger protein 963 2 6
MIRT577289 Zfp446 zinc finger protein 446 2 2
MIRT577554 Tdrd1 tudor domain containing 1 2 6
MIRT577573 Tctn3 tectonic family member 3 2 2
MIRT577705 Slc28a3 solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 2 2
MIRT577720 Slc22a15 solute carrier family 22 (organic anion/cation transporter), member 15 2 2
MIRT577765 Serpinb10 serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10 1 1
MIRT577864 Rassf5 Ras association (RalGDS/AF-6) domain family member 5 2 2
MIRT577925 Prl5a1 prolactin family 5, subfamily a, member 1 2 2
MIRT577975 Pira2 paired-Ig-like receptor A2 2 2
MIRT577982 Pira1 paired-Ig-like receptor A1 2 2
MIRT578457 Ints12 integrator complex subunit 12 2 2
MIRT578576 Hist1h1d histone cluster 1, H1d 2 2
MIRT578612 Haus2 HAUS augmin-like complex, subunit 2 2 2
MIRT578669 Gramd1c GRAM domain containing 1C 2 2
MIRT578694 Golt1a golgi transport 1A 2 2
MIRT578832 Fech ferrochelatase 2 2
MIRT578857 Mtfr2 mitochondrial fission regulator 2 1 3
MIRT578898 Erich1 glutamate rich 1 2 2
MIRT579230 Ccdc138 coiled-coil domain containing 138 2 2
MIRT579236 Casp8 caspase 8 2 2
MIRT579263 Bub1 BUB1, mitotic checkpoint serine/threonine kinase 2 2
MIRT579331 Atf7 activating transcription factor 7 2 2
MIRT579464 Acot11 acyl-CoA thioesterase 11 2 4
MIRT579502 A630001G21Rik RIKEN cDNA A630001G21 gene 2 2
MIRT579550 Tmem241 transmembrane protein 241 1 1
MIRT579628 Mettl20 electron transfer flavoprotein beta subunit lysine methyltransferase 1 1
MIRT579756 Zfp608 zinc finger protein 608 2 2
MIRT579920 Zbtb39 zinc finger and BTB domain containing 39 2 2
MIRT580179 Twist2 twist basic helix-loop-helix transcription factor 2 2 2
MIRT580204 Ttc7 tetratricopeptide repeat domain 7 2 2
MIRT580221 Tspan12 tetraspanin 12 2 2
MIRT580287 Trhr thyrotropin releasing hormone receptor 2 2
MIRT580313 Tnrc6b trinucleotide repeat containing 6b 2 2
MIRT580389 Slc35g1 solute carrier family 35, member G1 1 1
MIRT580402 Tmem167 transmembrane protein 167 2 2
MIRT580422 Tmem161b transmembrane protein 161B 2 2
MIRT580482 Tigd5 tigger transposable element derived 5 2 2
MIRT580511 Tet3 tet methylcytosine dioxygenase 3 2 2
MIRT580643 Stxbp6 syntaxin binding protein 6 (amisyn) 2 4
MIRT580700 Stard8 START domain containing 8 2 2
MIRT580754 Spry1 sprouty homolog 1 (Drosophila) 2 2
MIRT580818 Snx27 sorting nexin family member 27 2 2
MIRT580863 Slc8a1 solute carrier family 8 (sodium/calcium exchanger), member 1 2 2
MIRT580877 Slc7a11 solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 2 2
MIRT581027 Sipa1l1 signal-induced proliferation-associated 1 like 1 2 2
MIRT581107 Sept8 septin 8 2 2
MIRT581119 Sept3 septin 3 2 2
MIRT581208 Satb2 special AT-rich sequence binding protein 2 2 2
MIRT581412 Rbm47 RNA binding motif protein 47 2 4
MIRT581498 Pvrl4 nectin cell adhesion molecule 4 2 2
MIRT581511 Ptpro protein tyrosine phosphatase, receptor type, O 2 2
MIRT581550 Ptdss1 phosphatidylserine synthase 1 2 2
MIRT581612 Prkcd protein kinase C, delta 2 2
MIRT581621 Prkca protein kinase C, alpha 2 2
MIRT581701 Ppm1k protein phosphatase 1K (PP2C domain containing) 2 2
MIRT581727 Pofut1 protein O-fucosyltransferase 1 2 2
MIRT581758 Plxna1 plexin A1 2 2
MIRT581814 Plag1 pleiomorphic adenoma gene 1 2 2
MIRT581840 Piwil2 piwi-like RNA-mediated gene silencing 2 2 2
MIRT581872 Pik3ca phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha 2 2
MIRT581889 Pias1 protein inhibitor of activated STAT 1 2 2
MIRT581924 Pgm2l1 phosphoglucomutase 2-like 1 2 2
MIRT581979 Pcsk5 proprotein convertase subtilisin/kexin type 5 2 2
MIRT582089 Ogdh oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) 2 2
MIRT582162 Nln neurolysin (metallopeptidase M3 family) 2 2
MIRT582194 Nfkbia nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha 2 2
MIRT582310 Nacc2 nucleus accumbens associated 2, BEN and BTB (POZ) domain containing 2 8
MIRT582534 Mapk1 mitogen-activated protein kinase 1 2 2
MIRT582686 Lhfpl4 lipoma HMGIC fusion partner-like protein 4 2 6
MIRT582901 Il3 interleukin 3 2 2
MIRT582926 Il15ra interleukin 15 receptor, alpha chain 2 2
MIRT582947 Ikzf5 IKAROS family zinc finger 5 2 2
MIRT583009 Iars2 isoleucine-tRNA synthetase 2, mitochondrial 2 2
MIRT583029 Htt huntingtin 2 2
MIRT583120 Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 2 2
MIRT583215 Gpr123 adhesion G protein-coupled receptor A1 2 6
MIRT583298 Glra2 glycine receptor, alpha 2 subunit 2 2
MIRT583335 Paxbp1 PAX3 and PAX7 binding protein 1 1 3
MIRT583370 Gabra2 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 2 2 2
MIRT583404 Fzd3 frizzled class receptor 3 2 2
MIRT583537 Fbxo45 F-box protein 45 2 2
MIRT583598 Fam63b MINDY lysine 48 deubiquitinase 2 2 2
MIRT583638 Tmem236 transmembrane protein 236 1 1
MIRT583975 Dennd4a DENN/MADD domain containing 4A 2 2
MIRT584001 Dcdc2a doublecortin domain containing 2a 2 2
MIRT584050 Cysltr1 cysteinyl leukotriene receptor 1 2 2
MIRT584093 Csrnp3 cysteine-serine-rich nuclear protein 3 2 2
MIRT584300 Chic1 cysteine-rich hydrophobic domain 1 2 2
MIRT584316 Chek1 checkpoint kinase 1 2 6
MIRT584366 Cdk19 cyclin-dependent kinase 19 2 2
MIRT584724 Atp8b1 ATPase, class I, type 8B, member 1 2 2
MIRT584781 Arl8a ADP-ribosylation factor-like 8A 2 2
MIRT584804 Arl15 ADP-ribosylation factor-like 15 2 2
MIRT584827 Arhgef33 Rho guanine nucleotide exchange factor (GEF) 33 2 2
MIRT584906 Alg6 asparagine-linked glycosylation 6 (alpha-1,3,-glucosyltransferase) 2 2
MIRT584953 Adamts4 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4 2 6
MIRT585037 Lrrc71 leucine rich repeat containing 71 1 1
MIRT585057 Pcnxl4 pecanex homolog 4 1 1
MIRT585104 Zfp941 zinc finger protein 941 2 2
MIRT585152 Zfp874b zinc finger protein 874b 2 2
MIRT585337 Ybey ybeY metallopeptidase 2 2
MIRT585398 Wfdc12 WAP four-disulfide core domain 12 2 2
MIRT585482 Txlnb taxilin beta 2 2
MIRT585516 Trp53rk transformation related protein 53 regulating kinase B 2 2
MIRT585552 Tpte transmembrane phosphatase with tensin homology 2 2
MIRT585706 Tbc1d24 TBC1 domain family, member 24 2 2
MIRT585749 Stat1 signal transducer and activator of transcription 1 2 2
MIRT585894 Slc1a7 solute carrier family 1 (glutamate transporter), member 7 2 2
MIRT585919 Slc16a9 solute carrier family 16 (monocarboxylic acid transporters), member 9 2 2
MIRT586027 Sass6 SAS-6 centriolar assembly protein 2 4
MIRT586036 Rsad1 radical S-adenosyl methionine domain containing 1 2 2
MIRT586137 Rbm41 RNA binding motif protein 41 2 2
MIRT586185 Ptprr protein tyrosine phosphatase, receptor type, R 2 2
MIRT586347 Pdxk pyridoxal (pyridoxine, vitamin B6) kinase 2 2
MIRT586392 Padi2 peptidyl arginine deiminase, type II 2 4
MIRT586426 Oip5 Opa interacting protein 5 2 2
MIRT586504 Neu4 sialidase 4 2 2
MIRT586627 Mfsd2b major facilitator superfamily domain containing 2B 2 2
MIRT586676 Mbd4 methyl-CpG binding domain protein 4 2 2
MIRT586952 Gstt3 glutathione S-transferase, theta 3 2 2
MIRT587235 Nxpe3 neurexophilin and PC-esterase domain family, member 3 1 1
MIRT587548 Cxcl5 chemokine (C-X-C motif) ligand 5 2 2
MIRT587740 Cd28 CD28 antigen 2 2
MIRT587785 Ccpg1 cell cycle progression 1 2 2
MIRT587902 BC003965 cDNA sequence BC003965 2 2
MIRT588023 Akap7 A kinase (PRKA) anchor protein 7 2 2
MIRT588064 Fam211b leucine rich repeat containing 75B 1 1
MIRT588077 AI429214 expressed sequence AI429214 2 2
MIRT588154 Ccdc169 coiled-coil domain containing 169 1 1
MIRT588370 Zfp462 zinc finger protein 462 2 2
MIRT588437 Ythdc2 YTH domain containing 2 2 2
MIRT588493 Wbp4 WW domain binding protein 4 2 2
MIRT588518 Uty ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome 2 2
MIRT588605 Tsc22d3 TSC22 domain family, member 3 2 2
MIRT588652 Tmem200a transmembrane protein 200A 2 2
MIRT588747 Synj2bp synaptojanin 2 binding protein 2 2
MIRT588778 Strbp spermatid perinuclear RNA binding protein 2 2
MIRT588794 Ss18l1 SS18, nBAF chromatin remodeling complex subunit like 1 2 6
MIRT588817 Srgap3 SLIT-ROBO Rho GTPase activating protein 3 2 2
MIRT588838 Sort1 sortilin 1 2 2
MIRT588962 Scn2a1 sodium channel, voltage-gated, type II, alpha 2 2
MIRT589067 Rbbp9 retinoblastoma binding protein 9, serine hydrolase 2 2
MIRT589077 Rbbp5 retinoblastoma binding protein 5, histone lysine methyltransferase complex subunit 2 2
MIRT589087 Rasal2 RAS protein activator like 2 2 2
MIRT589114 Rasa2 RAS p21 protein activator 2 2 2
MIRT589121 Rai1 retinoic acid induced 1 2 2
MIRT589139 Rad51d RAD51 paralog D 1 1
MIRT589277 Pitpnb phosphatidylinositol transfer protein, beta 2 2
MIRT589409 Nrf1 nuclear respiratory factor 1 2 2
MIRT589459 Nceh1 neutral cholesterol ester hydrolase 1 2 2
MIRT589513 Mtf1 metal response element binding transcription factor 1 2 2
MIRT589634 Loxl3 lysyl oxidase-like 3 2 2
MIRT589758 Iws1 IWS1, SUPT6 interacting protein 2 2
MIRT589896 Gtpbp2 GTP binding protein 2 2 2
MIRT589946 Gfod1 glucose-fructose oxidoreductase domain containing 1 2 2
MIRT590058 Fbxl17 F-box and leucine-rich repeat protein 17 2 4
MIRT590129 Ephb3 Eph receptor B3 2 2
MIRT590405 Ccna2 cyclin A2 2 2
MIRT590436 Casz1 castor zinc finger 1 2 2
MIRT590466 Car5b carbonic anhydrase 5b, mitochondrial 2 2
MIRT590476 Camsap2 calmodulin regulated spectrin-associated protein family, member 2 1 1
MIRT590512 Bsn bassoon 2 6
MIRT590570 B3gnt2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 2
MIRT590731 Ado 2-aminoethanethiol (cysteamine) dioxygenase 2 2
MIRT590816 1110059G10Rik RIKEN cDNA 1110059G10 gene 2 2
MIRT591122 Oas3 2'-5' oligoadenylate synthetase 3 2 2
MIRT591368 E2f1 E2F transcription factor 1 2 2
MIRT592056 Tbc1d13 TBC1 domain family, member 13 2 2
MIRT592232 Ly96 lymphocyte antigen 96 2 2
MIRT592722 Fbxl14 F-box and leucine-rich repeat protein 14 2 6
MIRT592778 Diap2 diaphanous related formin 2 2 6
MIRT593254 Tas1r3 taste receptor, type 1, member 3 2 2
MIRT594456 Evi2b ecotropic viral integration site 2b 2 2
MIRT594616 Myt1l myelin transcription factor 1-like 2 2
MIRT594672 Ehf ets homologous factor 2 2
MIRT594751 Wdr89 WD repeat domain 89 2 2
MIRT595407 Arid2 AT rich interactive domain 2 (ARID, RFX-like) 2 2
MIRT595645 Abi3bp ABI gene family, member 3 (NESH) binding protein 2 2
MIRT603345 Slc16a10 solute carrier family 16 (monocarboxylic acid transporters), member 10 2 2
MIRT604327 Bpifc BPI fold containing family C 2 2
MIRT604500 2510049J12Rik makorin, ring finger protein 2, opposite strand 2 2
MIRT604864 Mef2a myocyte enhancer factor 2A 2 2
MIRT605407 Tacr2 tachykinin receptor 2 2 2
MIRT605870 Atpbd4 diphthamine biosynthesis 6 2 2
MIRT606108 Unc5c unc-5 netrin receptor C 2 2

Error report submission