miRTarBase - #MIRT578542


—
pre-miRNA Information
pre-miRNA mmu-mir-511   
Genomic Coordinates chr2: 14261003 - 14261081
Synonyms Mirn511, mmu-mir-511, Mir511
Description Mus musculus miR-511 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-511-3p
Sequence 49| AAUGUGUAGCAAAAGACAGGAU |70
Evidence Experimental
Experiments Illumina
Putative Targets

Gene Information
Gene Symbol Htr1f   
Synonyms Htr1eb
Description 5-hydroxytryptamine (serotonin) receptor 1F
Transcript NM_008310   
Expression
Putative miRNA Targets on Htr1f
3'UTR of Htr1f
(miRNA target sites are highlighted)		 
>Htr1f|NM_008310|3'UTR
   1 GATAAAAGAAACCTAATTTTAAAGTGCGGAGGCTTTATTTGTTGGGGGGAGGGGCAGGGATAATTAAATGAATGTAAAGT
  81 AAGAAAACATTTAAATTTTTAGAGAAAATATATTAAAACTGCTAAAATTATAAGAGGATAAATTTATTTTTAATAGCACC
 161 AAGAAAATAAGATGTATTCATTTGGCCATAATTTTAATGTTCTCAAGATTAGGAAATAATTTATGCAGCTCAGCTCGTAA
 241 TATTTTGTCTATGCAATATACCTAAGAAGCTAACTAGAAATACATATATATAATAATTGATAATATATGCATATATATTA
 321 TCAATTACAATGCTTTCCAGGTTTATATGTTACAACAACTAGAGACATTTTTAACTAGCATCTTTCCACTGGTAATTTCT
 401 GTCACCTCATTGCTTAACCACTATTTATAGAAAAATATTCAATGTAATGCTACTATTGCCCCTTCTCCATCTTCTCCACT
 481 ACAAAGGTGGAGATATAGCAACAGCAGCTCCTATTTAGCCTTAGCAGAGAAGATATGAAGCTCAGCGGCTTTGATAGTGT
 561 CCTCACATTTGGACAGTAAAAATAATCATCCAATGAGCTAGATATGGGAAATATTTCAATATCCTGCATTTTCTGCACAT
 641 TTGCAATCTTTACTTATTTTGATATCAAGTTCTAGAATAATATTATCTTAACCATATATCTGTATTTAAAATCAAAGCCC
 721 CAAGGTTAGAGGAAAGGTTTATTATGCAATTACTGTATAATTGTTATATACATTGCCCCCTGTCTAGGAATCAAGCTCTA
 801 AACACTAAGGACCTTAACTAACTCACTGTAATTAACATACTTCTAGTGTAAATTTTATTTTTCTCCACCAATATTATTAG
 881 GTCCAGTTTTTATAACTCATCTCCATATCTTAAGATCTGAACATCATTTCTTTTTTATTACAGAGAATATAATAAAAAAC
 961 TTAAAACTTTGCTTTGACTTTATAAAAAAAAGTTTTTCCTATTATAATTAGGACACCTTTCACAAATCAAGACCATTTGA
1041 AAAACAACGTATTTGAAAAACGACACATACATTTGAAATGTAAATAAAGAAAATATCT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaGGACAGAAAACGAUGUGUAa 5'
            |||| | ||| ||:||||| 
Target 5' atCCTG-CATTTTCTGCACATt 3'
 621 - 641 155.00 -18.70
2 
miRNA  3' uagGACAGA-AAACG--AUGUGUAa 5'
             |||| |  |||:  ||:|||| 
Target 5' ttaCTGTATAATTGTTATATACATt 3'
 750 - 774 141.00 -10.70
3 
miRNA  3' uaggacagaAAACG-AUGUGUAa 5'
                   | ||| ||:|:|| 
Target 5' ttgataataTATGCATATATATt 3'
 297 - 319 117.00 -6.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
CLIP-seq Support 1 for dataset GSM1385342
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_GM_Ago2_CLIP-Seq_myoblast
Location of target site NM_008310 | 3UTR | ACAUACAUUUGAAAUGUAAAUAAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1385343
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_DM_Ago2_CLIP-Seq_myotubes
Location of target site NM_008310 | 3UTR | ACAUACAUUUGAAAUGUAAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
131 mmu-miR-511-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007042 Rock2 Rho-associated coiled-coil containing protein kinase 2 1 1
MIRT410979 Ado 2-aminoethanethiol (cysteamine) dioxygenase 2 2
MIRT577699 Slc28a3 solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 2 2
MIRT577858 Rassf5 Ras association (RalGDS/AF-6) domain family member 5 2 2
MIRT578125 Nqo2 N-ribosyldihydronicotinamide quinone reductase 2 2 2
MIRT578178 Neu1 neuraminidase 1 2 2
MIRT578289 Mavs mitochondrial antiviral signaling protein 2 2
MIRT578542 Htr1f 5-hydroxytryptamine (serotonin) receptor 1F 2 2
MIRT578630 Gtf2h2 general transcription factor II H, polypeptide 2 2 2
MIRT578655 Gramd1c GRAM domain containing 1C 2 2
MIRT578681 Golt1a golgi transport 1A 2 2
MIRT578805 Folh1 folate hydrolase 1 2 2
MIRT578909 Entpd1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT579078 Cox15 cytochrome c oxidase assembly protein 15 2 4
MIRT579092 Cnih3 cornichon family AMPA receptor auxiliary protein 3 2 4
MIRT579359 Aplnr apelin receptor 2 2
MIRT579390 Alkbh1 alkB homolog 1, histone H2A dioxygenase 2 6
MIRT579984 Wnt7a wingless-type MMTV integration site family, member 7A 2 2
MIRT580016 Whsc1l1 nuclear receptor binding SET domain protein 3 2 4
MIRT580121 Ubn2 ubinuclein 2 2 2
MIRT580264 Trim12c tripartite motif-containing 12C 2 2
MIRT580360 Tmem26 transmembrane protein 26 2 2
MIRT580400 Tmem170b transmembrane protein 170B 2 2
MIRT580449 Tln2 talin 2 2 2
MIRT580833 Smarca2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 2 2
MIRT580872 Slc7a11 solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 2 2
MIRT581115 Sept3 septin 3 2 2
MIRT581330 Rgs8 regulator of G-protein signaling 8 2 2
MIRT581475 Rabgap1 RAB GTPase activating protein 1 2 2
MIRT581599 Prkcd protein kinase C, delta 2 2
MIRT581810 Plag1 pleiomorphic adenoma gene 1 2 2
MIRT581916 Pgm3 phosphoglucomutase 3 2 2
MIRT582067 Onecut2 one cut domain, family member 2 2 2
MIRT582557 Mal2 mal, T cell differentiation protein 2 2 2
MIRT582599 Lrrc40 leucine rich repeat containing 40 2 2
MIRT582756 Klf8 Kruppel-like factor 8 2 2
MIRT582969 Igf2 insulin-like growth factor 2 2 4
MIRT583021 Htt huntingtin 2 2
MIRT583256 Gnb4 guanine nucleotide binding protein (G protein), beta 4 2 4
MIRT583615 Fam46a family with sequence similarity 46, member A 2 2
MIRT583904 Drp2 dystrophin related protein 2 2 2
MIRT584439 Ccdc85a coiled-coil domain containing 85A 2 2
MIRT584855 Appl1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 2 2
MIRT585490 Txlnb taxilin beta 2 2
MIRT585697 Tbc1d24 TBC1 domain family, member 24 2 2
MIRT585737 Steap2 six transmembrane epithelial antigen of prostate 2 2 2
MIRT585876 Slc22a8 solute carrier family 22 (organic anion transporter), member 8 2 8
MIRT585961 Sike1 suppressor of IKBKE 1 2 6
MIRT586179 Ptprr protein tyrosine phosphatase, receptor type, R 2 2
MIRT586592 Mrgpre MAS-related GPR, member E 2 2
MIRT586808 Ints8 integrator complex subunit 8 2 2
MIRT586916 Heatr2 dynein, axonemal assembly factor 5 2 4
MIRT586949 Gstt3 glutathione S-transferase, theta 3 2 2
MIRT587148 Gcnt4 glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase) 2 2
MIRT587226 Nxpe3 neurexophilin and PC-esterase domain family, member 3 1 1
MIRT587477 D630045J12Rik RIKEN cDNA D630045J12 gene 2 8
MIRT587487 D630003M21Rik RIKEN cDNA D630003M21 gene 2 2
MIRT587601 Cml2 N-acetyltransferase 8 (GCN5-related) family member 2 2 2
MIRT587746 Cd28 CD28 antigen 2 2
MIRT587777 Ccpg1 cell cycle progression 1 2 2
MIRT587838 Casp8 caspase 8 2 4
MIRT588179 A530054K11Rik zinc finger protein 729a 2 2
MIRT588286 1700019G17Rik N-acetyltransferase 8 (GCN5-related) family member 4 2 2
MIRT588363 Zfp518b zinc finger protein 518B 2 2
MIRT588390 Zeb2 zinc finger E-box binding homeobox 2 2 2
MIRT588545 Uhrf1bp1l UHRF1 (ICBP90) binding protein 1-like 2 2
MIRT588613 Tsc22d3 TSC22 domain family, member 3 2 2
MIRT588648 Tmem200a transmembrane protein 200A 2 2
MIRT588722 Tbx22 T-box 22 2 2
MIRT589666 Lcorl ligand dependent nuclear receptor corepressor-like 2 2
MIRT589865 Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 2 2
MIRT589974 Gabpb2 GA repeat binding protein, beta 2 2 2
MIRT590191 Ell2 elongation factor RNA polymerase II 2 2 2
MIRT590365 Clca2 chloride channel accessory 3A2 2 2
MIRT590839 Wdr46 WD repeat domain 46 2 2
MIRT590855 Vps33b vacuolar protein sorting 33B 2 4
MIRT590931 Supt7l suppressor of Ty 7-like 2 2
MIRT591032 Rfx3 regulatory factor X, 3 (influences HLA class II expression) 2 2
MIRT591224 Ly96 lymphocyte antigen 96 2 2
MIRT591305 Il18r1 interleukin 18 receptor 1 2 2
MIRT591362 Egfl6 EGF-like-domain, multiple 6 2 2
MIRT591431 Car10 carbonic anhydrase 10 2 4
MIRT591524 Abcc9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 2 2
MIRT591574 Zfhx3 zinc finger homeobox 3 2 4
MIRT591596 Xrcc3 X-ray repair complementing defective repair in Chinese hamster cells 3 2 2
MIRT591612 Vps37a vacuolar protein sorting 37A 2 2
MIRT591706 Rpusd2 RNA pseudouridylate synthase domain containing 2 2 2
MIRT591719 Rorb RAR-related orphan receptor beta 2 4
MIRT591738 Rab9b RAB9B, member RAS oncogene family 2 4
MIRT591833 Lin7a lin-7 homolog A (C. elegans) 2 2
MIRT591845 Iglon5 IgLON family member 5 2 2
MIRT591896 Fbrs fibrosin 2 2
MIRT591953 Ceacam1 carcinoembryonic antigen-related cell adhesion molecule 1 2 2
MIRT592281 Gatc glutamyl-tRNA(Gln) amidotransferase, subunit C 2 2
MIRT592403 Tmco1 transmembrane and coiled-coil domains 1 2 2
MIRT592457 Ski ski sarcoma viral oncogene homolog (avian) 2 2
MIRT592464 Runx1 runt related transcription factor 1 2 2
MIRT592652 Lifr leukemia inhibitory factor receptor 2 2
MIRT592681 Has2 hyaluronan synthase 2 2 2
MIRT592828 Asb7 ankyrin repeat and SOCS box-containing 7 2 2
MIRT592841 Akap2 A kinase (PRKA) anchor protein 2 2 2
MIRT593386 Adra1b adrenergic receptor, alpha 1b 2 2
MIRT593398 Znrf3 zinc and ring finger 3 2 2
MIRT593410 Slc6a6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 2 2
MIRT594175 Vdr vitamin D (1,25-dihydroxyvitamin D3) receptor 2 2
MIRT594720 Zfp931 zinc finger protein 931 2 2
MIRT594897 Ifi204 interferon activated gene 204 2 2
MIRT594917 Gm14326 predicted gene 14326 2 2
MIRT594951 Fblim1 filamin binding LIM protein 1 2 2
MIRT595342 Frmd4a FERM domain containing 4A 2 2
MIRT595370 Fam168b family with sequence similarity 168, member B 2 2
MIRT595396 Bcl10 B cell leukemia/lymphoma 10 2 2
MIRT595401 Arsk arylsulfatase K 2 2
MIRT595424 Adamts12 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12 2 2
MIRT595429 A630033H20Rik RIKEN cDNA A630033H20 gene 2 2
MIRT595440 9030617O03Rik D-glutamate cyclase 2 2
MIRT595727 B2m beta-2 microglobulin 2 2
MIRT601791 Rab27a RAB27A, member RAS oncogene family 2 2
MIRT602942 Xpo7 exportin 7 2 2
MIRT604983 Fsd1l fibronectin type III and SPRY domain containing 1-like 2 2
MIRT605311 Zfp92 zinc finger protein 92 2 2
MIRT605455 St18 suppression of tumorigenicity 18 2 2
MIRT605533 Pstpip2 proline-serine-threonine phosphatase-interacting protein 2 2 2
MIRT605596 Nbeal1 neurobeachin like 1 2 2
MIRT605765 Epas1 endothelial PAS domain protein 1 2 2
MIRT605940 Sema6a sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 2 2
MIRT605982 Mylk4 myosin light chain kinase family, member 4 2 2
MIRT606186 Slc5a8 solute carrier family 5 (iodide transporter), member 8 2 2
MIRT606235 Rab3c RAB3C, member RAS oncogene family 2 2
MIRT606619 Rbfox2 RNA binding protein, fox-1 homolog (C. elegans) 2 2 2
MIRT755997 Tlr4 toll-like receptor 4 3 1

Error report submission