pre-miRNA Information
pre-miRNA mmu-mir-16-1   
Genomic Coordinates chr14: 61631880 - 61631972
Description Mus musculus miR-16-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA mmu-mir-16-2   
Genomic Coordinates chr3: 69009902 - 69009996
Synonyms Mirn16, Mirn16-1, miR-16, mir-16-1, Mir16-1, Mirn16-2, mir-16-2, Mir16-2
Description Mus musculus miR-16-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-16-5p
Sequence 17| UAGCAGCACGUAAAUAUUGGCG |38
Evidence Experimental
Experiments Cloned
Putative Targets

Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B3XID9 miR-16 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
B08JQH miR-16-5p Predictive Biomarker (PRD) Clinical/Experimental Data Expression . Peripheral blood MicroRNA sequencing
Gene Information
Gene Symbol Dhdh   
Synonyms 1300018L09Rik, AA591799, Xld-1, Xld1
Description dihydrodiol dehydrogenase (dimeric)
Transcript NM_027903   
Expression
Putative miRNA Targets on Dhdh
3'UTR of Dhdh
(miRNA target sites are highlighted)
>Dhdh|NM_027903|3'UTR
   1 TACAGCTCCTGCGACAGATGTGTGTGGCAAGCAACCTTCCCTCCTGCTTGGACCTCTGTAACCTGACTCTCATTGCTTTG
  81 GAGTTGTTGTTGTTGTTGTTGTTGTTGCTGCTGCTGCTGCTGCAAATCAGCACGTGTTCTCTCCCTTTCTGGGTGTTGGG
 161 AGCCAGCTTTGATGAGTCAGGGTGTGGAGTCAGGGGAGTCTACAGACACCAAAGCTTCTTTCTAGGACAAACAGGTTCTC
 241 TCTTTACTTTAGGGGGAAACACACGCACACGCACACGCACACGCACACACACACACACACACTTGATGGATGAAGCTAGG
 321 CTCCAACAACTTTATTTTTCCCCCATATCCCCCAGCAAACTCTTTGAAGAAGTATAAAAATTACAATGTGGTTACATTCT
 401 ATCTTTAAGTGGATGAATAAATGAAGTACAATGAGTTCAAGTAAAAACAACAACTACAAAGCCCAGCAGGCCCCCAGCAC
 481 CCTTACACAATTAAGCAATTTATATATTACATGCAGAAAACAGATTATTAACATGAATCCACATACATTCCTGTCTAAGC
 561 AACTTGTTATAGACTAACAAACTGTGGGTAAAAAAGGTATTTTTTTCTCAGCCAGTTCTTTGACTGGCAAGCTGCAATTT
 641 GTGATTATGAAGAAAGGAACAATCATTTTGTTATTTGTCCTGAAAAGTAATTTTTAAAATTATTCACTTTACACCCCAGT
 721 ATCAGCCCCACCTATCTCCTCCCAGTCCTCCCTTCACACAGCTCAGCTCCCCCCCCATTCCCTCTCTTCCTCTGAGAAGG
 801 GGGAAGCTCCCCTGGGTACCACACACACACACACACACACACACTCACACACACACACACAAACACACTCACACACACAC
 881 ACACACACACACACACAGCATATGGAGTCACTGCAGGACTAAGTGCATCCTCTCCCACTGAAGCCAGATGAAACAGCCCA
 961 GTTAGGGGAATGGGATCCACAGGCAGGCAATAGATTCAGGAACTAAATGTAATCATAAAAAACTTAAAGAATCACAAATC
1041 TAAACTTTTATATAAAAAAAACAGTCCTTTCTACTTTAAATCCTCGGGTACATAAACAAAAACCTGTTTCTGGTTGCGGT
1121 GTGGTTCAGCCCTTGGCATATACACCTTTAATTCAAAACAATGGAGGTAAAGTTAGTTTGTAAAAGGAAGCACCCATGTT
1201 TGAAAGTGATGTCTAATTGAGTGGCAAGCAACAAATCAGATTTGACAGACTAGGATGTGCCCAGCTCCCATGAGAGCAGA
1281 GAGGAGAGAGAGAGAGACTGCTTTAAGAGAGCAAGGCAGGGCGATAGGAAGGAGGAGGAGGCAGGCTACTGCTACAGAGA
1361 CAGGTTGAACAGAGAACAAGCTAGACTCAGGGGAAGACAGAACAAGCCAGGGAGTGAGAAGGAGCCAGAAGATAAGAACA
1441 CATTGCCAGAGTTAGTTTGAGGCCAAGCAGAACAACCCAGTTAGAGGCTGAGAGAAGCCAGACTGGATCAGTCAGCTTAG
1521 AAAGGAGTTTGAGCCAGAACAACTGAGTTCAGAAAGAAAAAGCTTATTCAGAGTAAGTCTCAGAGGCTGAAACAGTGTAG
1601 ACCTAGATAAGATTGTGCGGAGGCTAGAAGCTTGCAGGCCTAGGGTCAACTATCAAAAGTGTGCTCTTCTAAATTTAAAT
1681 TGTTCCCCAAGATTTTCTACATT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gcgguuAUA--AAUGCACGACGAu 5'
                |:|  ||:| ||||||| 
Target 5' tgttgtTGTTGTTGC-TGCTGCTg 3'
94 - 116 149.00 -14.00
2
miRNA  3' gcgGUUAUAAAUGCACGACGAu 5'
             |||   || | | ||||| 
Target 5' aagCAA-CCTTCCCTCCTGCTt 3'
29 - 49 118.00 -7.00
3
miRNA  3' gcGGUUAU-AAA--UGCACGACGAu 5'
            :|| |: |||  |  ||:||:| 
Target 5' tcTCATTGCTTTGGAGTTGTTGTTg 3'
68 - 92 118.00 -7.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions mESCs
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM622574. RNA binding protein: AGO2. Condition:KO2 ...

- Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gcgguuAUA--AAUGCACGACGAu 5'
                |:|  ||:| ||||||| 
Target 5' uguuguUGUUGUUGC-UGCUGCUg 3'
15 - 37
2
miRNA  3' gcgguuauaaaugcACGACGAu 5'
                        ||:||:| 
Target 5' ---------ggaguUGUUGUUg 3'
1 - 13
Article - Leung AK; Young AG; Bhutkar A; Zheng GX; et al.
- Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
51 mmu-miR-16-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001064 Wnt3a wingless-type MMTV integration site family, member 3A 4 1
MIRT001065 Ccnd1 cyclin D1 4 2
MIRT001066 Bcl2 B cell leukemia/lymphoma 2 4 2
MIRT001689 Ccnt2 cyclin T2 1 1
MIRT003375 Arl2 ADP-ribosylation factor-like 2 4 1
MIRT004105 Cadm1 cell adhesion molecule 1 2 1
MIRT005352 App amyloid beta (A4) precursor protein 4 1
MIRT005922 Mdm4 transformed mouse 3T3 cell double minute 4 3 1
MIRT005923 Vegfa vascular endothelial growth factor A 4 3
MIRT005924 Jun jun proto-oncogene 3 1
MIRT005925 Jag1 jagged 1 3 1
MIRT006566 Slc6a4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1 1
MIRT006940 Ccne1 cyclin E1 3 2
MIRT427938 Ppap2b phospholipid phosphatase 3 3 1
MIRT438298 Bcl2l2 BCL2-like 2 1 1
MIRT438763 Cd40 CD40 antigen 3 1
MIRT438766 Fgf2 fibroblast growth factor 2 3 1
MIRT577813 Rnf168 ring finger protein 168 1 1
MIRT578440 Irgq immunity-related GTPase family, Q 1 5
MIRT578972 Dhdh dihydrodiol dehydrogenase (dimeric) 1 2
MIRT583721 Erlin2 ER lipid raft associated 2 1 1
MIRT584146 Creb5 cAMP responsive element binding protein 5 1 1
MIRT591285 Klc1 kinesin light chain 1 1 2
MIRT591939 Ddx19b DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b 1 1
MIRT592081 Sorcs2 sortilin-related VPS10 domain containing receptor 2 1 1
MIRT592201 Mapkap1 mitogen-activated protein kinase associated protein 1 1 2
MIRT592347 Armcx6 armadillo repeat containing, X-linked 6 1 2
MIRT592355 Angel1 angel homolog 1 1 1
MIRT592370 4930444A02Rik protein-O-mannose kinase 1 1
MIRT592407 Tacc1 transforming, acidic coiled-coil containing protein 1 1 2
MIRT592431 Spsb4 splA/ryanodine receptor domain and SOCS box containing 4 1 1
MIRT592665 Itgav integrin alpha V 1 1
MIRT592716 Fbxo21 F-box protein 21 1 2
MIRT592808 Bicd1 bicaudal D homolog 1 (Drosophila) 1 3
MIRT597924 Pacsin2 protein kinase C and casein kinase substrate in neurons 2 1 1
MIRT598104 Ncl nucleolin 1 1
MIRT598638 Idua iduronidase, alpha-L- 1 1
MIRT599012 Fgd4 FYVE, RhoGEF and PH domain containing 4 1 1
MIRT600261 Trim2 tripartite motif-containing 2 1 1
MIRT600294 Tifab TRAF-interacting protein with forkhead-associated domain, family member B 1 1
MIRT601126 Bri3bp Bri3 binding protein 1 1
MIRT601137 Bcl11b B cell leukemia/lymphoma 11B 1 1
MIRT603793 Lpcat2b lysophosphatidylcholine acyltransferase 2B 1 1
MIRT733369 Synrg synergin, gamma 1 0
MIRT733370 Tnrc6b trinucleotide repeat containing 6b 1 0
MIRT733372 Lamtor3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 1 0
MIRT733373 Hip1 huntingtin interacting protein 1 1 0
MIRT733374 Il6ra interleukin 6 receptor, alpha 1 0
MIRT735570 CXCL10 C-X-C motif chemokine ligand 10 3 0
MIRT736046 Il7r interleukin 7 receptor 2 0
MIRT756040 Rbfox2 RNA binding protein, fox-1 homolog (C. elegans) 2 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-16 cisplatin approved 84093 Quantitative real-time PCR K562 cell 20428827 2010 up-regulated
miR-16 Cisplatin approved 84093 Quantitative real-time PCR SH-SY5Y cells 24026226 2013 up-regualted
miR-16 Benzo(a)pyrene NULL 2336 Microarray MM plasma cells 24798859 2014 up-regulated
miR-16 Calcium sulfate (CaS) NULL 24497 Microarray MG63E osteoblast-like cells 17618507 2008 down-regulated
miR-16 Glucocorticoid NULL NULL Microarray acute lymphoblastic leukemia 19148136 2009 up-regulated
miR-16 Glucocorticoid NULL NULL Northern blot acute lymphoblastic leukemia 19148136 2009 up-regulated
miR-16 Glucocorticoid NULL NULL Quantitative real-time PCR acute lymphoblastic leukemia 19148136 2009 up-regulated
miR-16 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-16 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-16 Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-16 All-trans-retinoic acid (ATRA) approved 444795 Quantitative real-time PCR acute promyelocytic leukemia (APL) 19749800 2009 up-regulated
miR-16 Curcumin NULL 969516 Quantitative real-time PCR MCF-7 cells 19908170 2010 up-regulated
miR-16 Glucose NULL 5793 Microarray proximal tubule cell line HK-2 20067797 2010 down-regulated
miR-16 Bisphenol A NULL 6623 Microarray immortalized cytotrophoblast cell lines HTR-8 20417706 2010 up-regulated
miR-16 Polylysine NULL 162282 Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-16 Trypaflavine NULL NULL Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-16 Nicotine approved 89594 Quantitative real-time PCR gastric cancer cells 21081469 2011 up-regulated
miR-16 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-16 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-16 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-16 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
miR-16 5-Fluorouracil approved 3385 Quantitative real-time PCR MCF-7 breast cancer cells 21506117 2011 up-regulated
miR-16 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-16 Estrogen NULL NULL Quantitative real-time PCR breast cancer cells. 22260523 2012 down-regulated
miR-16 Cisplatin approved 84093 Quantitative real-time PCR HeLa cells 22475935 2012 up-regulated
miR-16 Bortezomib approved 387447 Quantitative real-time PCR bone marrow stromal cells (BMSCs) 22781767 2012 up-regulated
miR-16 Melphalan approved 460612 Quantitative real-time PCR bone marrow stromal cells (BMSCs) 22781767 2012 up-regulated
miR-16 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-16 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-16 Tamoxifen approved 2733526 Quantitative real-time PCR rat liver 17343880 2007 up-regulated
miR-16 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-16 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-16 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-16 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miR-16 Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 up-regulated
miR-16 Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-16-5p Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer tissue and cell line
mmu-miR-16-5p Vincristine 5978 approved sensitive Low Gastric Cancer tissue and cell line (NF-3xmir16)
mmu-miR-16-5p Doxorubicin 31703 NSC123127 approved sensitive Low Gastric Cancer tissue and cell line (SGC7901)

Error report submission