>Cd70|NM_011617|3'UTR
   1 CCACAACTCCAGGATGACTTGTGAATATTTTTTTTCTTTTCAAGTTCTACGTATTTATAAATGTATATAGTACACATA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cuuucacauacccgaAACACUu 5' |||||| Target 5' caactccaggatgacTTGTGAa 3'	4 - 25	120.00	-7.00

- Cell, 2014

MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.