miRTarBase - #MIRT579257


—
pre-miRNA Information
pre-miRNA mmu-mir-374c   
Genomic Coordinates chrX: 103573085 - 103573133
Description Mus musculus miR-374c stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-374c-5p
Sequence 2| AUAAUACAACCUGCUAAGUG |21
Evidence Experimental
Experiments Illumina
Putative Targets

Gene Information
Gene Symbol C2cd3   
Synonyms AU020772
Description C2 calcium-dependent domain containing 3
Transcript NM_001017985   
Expression
Putative miRNA Targets on C2cd3
3'UTR of C2cd3
(miRNA target sites are highlighted)		 
>C2cd3|NM_001017985|3'UTR
   1 GGGACGTGGCTACCAGCCAGCCTCTCAGCTCTGTAAAGCTTGCAAGAGACAACAGGCCTGTTTCCCTCAGCATCCTCAGG
  81 CCACTAGCATCACCCTATTCCATGGGTATCTTGAGACCTAATCAGCTAAGACCAGAGGAGTGTCCCAAACCACCTAGCAG
 161 CTGCCTACCAGGACCTCAGCTTCCTTCTGTAATGAGGTGACTGCTGGAAGTGAGACTCAAGCACCCAAGTGTCCCACCCA
 241 TCTTCTGACTGTGGGGCCTAAGGAGGCCTCTCTGAGCAGAGAAACCAGTGTCCTTGACACAGCCTACTGCTGACCAGAGC
 321 CCACCTTCTGCTTAAATAGGACAGGCTATTTTTGCCATAAATATTGGAAGAAACATGGAATAAGTATGTACATAGCTGAG
 401 AAAATTCCAGAGCCCTGTCCAGCTTGTTTGTTTGGGAATGAGGTATTTTATAGATATAAATTATTTTTATGATGTATTAA
 481 TCAATAGAACAGGGGAATTGCCTCCTTTAAAACTGTATTCGGTTGTCTGAAATTTAACCATGTTTTTAACATAATGTTTG
 561 TTTCTACTCAGCTCTGAAATTCATTGCTCTTGCCTTTGTTTTTAATAAAAGTCTGGCATTTGTATTTGTGT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gugaAUCGUCCAACAUAAua 5'
              |:|||  |||||||  
Target 5' agtcTGGCA-TTTGTATTtg 3'
 610 - 628 135.00 -6.70
2 
miRNA  3' gugaaUCGUCC-AACAUAaua 5'
               | ||||  ||| |   
Target 5' gagacAACAGGCCTGTTTccc 3'
 46 - 66 79.00 -5.73
3 
miRNA  3' guGAAUCGUCCAAC--AUaaua 5'
            | ||||| | ||  ||    
Target 5' caCCTAGCA-GCTGCCTAccag 3'
 151 - 171 61.00 -8.12
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
30 mmu-miR-374c-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT577640 Spam1 sperm adhesion molecule 1 1 1
MIRT577871 Rassf5 Ras association (RalGDS/AF-6) domain family member 5 1 1
MIRT578592 Hist1h1d histone cluster 1, H1d 1 4
MIRT579257 C2cd3 C2 calcium-dependent domain containing 3 1 1
MIRT580257 Trim2 tripartite motif-containing 2 1 1
MIRT580529 Tead3 TEA domain family member 3 1 1
MIRT580992 Six6 sine oculis-related homeobox 6 1 1
MIRT581138 Senp5 SUMO/sentrin specific peptidase 5 1 2
MIRT581505 Pvrl1 nectin cell adhesion molecule 1 1 1
MIRT582082 Ogfod1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 2
MIRT582412 Mphosph9 M-phase phosphoprotein 9 1 2
MIRT582801 Kcnmb2 potassium large conductance calcium-activated channel, subfamily M, beta member 2 1 1
MIRT583138 Hao1 hydroxyacid oxidase 1, liver 1 1
MIRT583308 Gfra2 glial cell line derived neurotrophic factor family receptor alpha 2 1 1
MIRT583344 Gbp7 guanylate binding protein 7 1 2
MIRT583787 Elovl5 ELOVL family member 5, elongation of long chain fatty acids (yeast) 1 1
MIRT586006 Sec61b Sec61 beta subunit 1 1
MIRT586516 Ndufaf4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4 1 1
MIRT587446 Dimt1 DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) 1 1
MIRT588165 Ccdc169 coiled-coil domain containing 169 1 1
MIRT593026 Rassf10 Ras association (RalGDS/AF-6) domain family (N-terminal) member 10 1 2
MIRT593197 Adcyap1r1 adenylate cyclase activating polypeptide 1 receptor 1 1 1
MIRT594344 Mfsd11 major facilitator superfamily domain containing 11 1 1
MIRT595641 Abi3bp ABI gene family, member 3 (NESH) binding protein 1 1
MIRT596220 Ceacam1 carcinoembryonic antigen-related cell adhesion molecule 1 1 1
MIRT596378 Pde4dip phosphodiesterase 4D interacting protein (myomegalin) 1 1
MIRT597866 Pdxk pyridoxal (pyridoxine, vitamin B6) kinase 1 1
MIRT603416 Rwdd4a RWD domain containing 4A 1 1
MIRT603774 Magee1 melanoma antigen, family E, 1 1 1
MIRT606245 Ptgr2 prostaglandin reductase 2 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-374c 5-Fluorouraci + cisplatin approved NULL Microarray CNE cells 22614822 2012 up-regulated

Error report submission