pre-miRNA Information
pre-miRNA mmu-mir-30a   
Genomic Coordinates chr1: 23272269 - 23272339
Synonyms Mirn30a, mmu-mir-30a, Mir30a
Description Mus musculus miR-30a stem-loop
Comment Landgraf et al. confirm that the 5' mature miRNA product is the predominant one .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-30a-5p
Sequence 6| UGUAAACAUCCUCGACUGGAAG |27
Evidence Experimental
Experiments Cloned
Putative Targets

Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BJYS06 miR-30a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma MiRNA microarray; RT-PCR
BGDM03 miR-30a-5p Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Real-time polymerase chain reaction
Gene Information
Gene Symbol Wdr44   
Synonyms 2610034K17Rik, RAB11BP, RPH11
Description WD repeat domain 44
Transcript NM_175180   
Expression
Putative miRNA Targets on Wdr44
3'UTR of Wdr44
(miRNA target sites are highlighted)
>Wdr44|NM_175180|3'UTR
   1 TTTGAAATTATATTTAAAATAAACATATCAGTAAGTTTCTATATGTATCATAAATGAGAAAAGTATTATAGTGTTTCAGG
  81 CTAACATCCCTTTTTAGCTTTTATTGAAAGTTGTTCAAATATAATATATATTTTTTGAGAGGCAGTGTTAGTGATCTAGG
 161 AACTCCTAGACTGATAGACTAGAAAAGAATGTGGTTAGATTAACATTGCCAAGCATAGAGTTTATGTTTTGTTATGTTTA
 241 TGTTTTGTTATATAATTATAAACATGCACAGGTTTCTGCATGAAAAGATATTAATATATTAATCACATGTGCGTGCCTTT
 321 TGGTTACATGCACTAAATCTAACAAAGTTAAATTATTTTGGTGGCTCTTTTGGCCTCCTACTGGGTGAGGTGGTCTTGTT
 401 TCTAGTTCTAAAAAATTTTTTTGCACAAAATTTCGTTTTTAAGAAATGTATCTTTTGACTGAATTATTGTTTTGAAATGT
 481 TATATAGGTTTTCAATAGGTCAATAACCATGTGTAAATGGTTTTTTATAAATTTCTCAATTTGGGGACAAGATTTTTTTT
 561 GTGATCTAAATTGTGGACTTATTCTTTACTTTGTAAGTGTATATATATATAATTTTTTTCTTTGCCACACTGGAGCACAA
 641 TGTTTCTATGTAAAGAATTCTTTTCTTTATCCATGAGCACCAGGCTTTGCTCACTTAAAAATAAGCCACATTAAGGAGTG
 721 AGTCTTCTTTTTTACAATAATGTAAAAATGAACTGTTTACATTTTTTTAAAGCATTGTAGTTTTTAAAAAAAAATAAGCT
 801 GTTTTGTTTTGTGTTGTTGAATTTGAAAGGCTTTGTAAATACCAATATAATGTACCAATGAAATAACATCTGGGACAATA
 881 GAACCCTGGTAATGTTGTTGATGGTTTGCATATGTTTCTGAAACTGAAGTATGTATCATTAAAGTTGGTCATCAACACTT
 961 GTTAAAGGTGAAATATTTTGAGATGACATTATTAAATCAAAAGATGCAAGAAAAATAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gaaggucagcUCCU--ACAAAUGu 5'
                    | ||  ||||||| 
Target 5' taatgtaaaaATGAACTGTTTACa 3'
738 - 761 142.00 -7.70
2
miRNA  3' gaagGUCAGCUC---CUACAAAugu 5'
              || | |||    ||||||   
Target 5' gccaCACTGGAGCACAATGTTTcta 3'
624 - 648 114.00 -6.70
3
miRNA  3' gaagguCAGCUCCUA-CAAAUGu 5'
                ||:|  ||| ||||:| 
Target 5' ggtaatGTTGTTGATGGTTTGCa 3'
888 - 910 112.00 -11.30
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gaaggucagcuccuaCAAAUGu 5'
                         |||||| 
Target 5' ---------------GUUUACa 3'
1 - 7
Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
57 mmu-miR-30a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003714 Ak1 adenylate kinase 1 4 1
MIRT003715 Tnrc6a trinucleotide repeat containing 6a 4 1
MIRT003716 Abcb1b ATP-binding cassette, sub-family B (MDR/TAP), member 1B 3 1
MIRT003717 Inhba inhibin beta-A 3 1
MIRT003718 Egfr epidermal growth factor receptor 4 2
MIRT004770 Bdnf brain derived neurotrophic factor 5 2
MIRT007045 Snai1 snail family zinc finger 1 2 1
MIRT054524 Ccne2 cyclin E2 2 1
MIRT054525 Celsr3 cadherin, EGF LAG seven-pass G-type receptor 3 2 1
MIRT054526 Mdm2 transformed mouse 3T3 cell double minute 2 2 1
MIRT054527 Mtdh metadherin 3 2
MIRT054528 Smad1 SMAD family member 1 2 1
MIRT054529 Twf1 twinfilin actin binding protein 1 2 1
MIRT054530 Timp3 tissue inhibitor of metalloproteinase 3 2 1
MIRT577999 Pgr progesterone receptor 1 1
MIRT578189 Narg2 interactor of little elongation complex ELL subunit 2 1 1
MIRT578280 Mesdc2 mesoderm development LRP chaperone 1 1
MIRT578462 Ints12 integrator complex subunit 12 1 1
MIRT578487 Il18r1 interleukin 18 receptor 1 1 2
MIRT580036 Wdr89 WD repeat domain 89 1 3
MIRT580042 Wdr44 WD repeat domain 44 1 1
MIRT580299 Tomm70a translocase of outer mitochondrial membrane 70 homolog A (yeast) 1 1
MIRT581001 Six4 sine oculis-related homeobox 4 1 1
MIRT581268 Rrad Ras-related associated with diabetes 1 1
MIRT582213 Nfatc3 nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3 1 1
MIRT582448 Mgea5 meningioma expressed antigen 5 (hyaluronidase) 1 1
MIRT583057 Hoxb3 homeobox B3 1 1
MIRT583627 Strip1 striatin interacting protein 1 1 1
MIRT583684 Amer1 APC membrane recruitment 1 1 1
MIRT583926 Dpy19l1 dpy-19-like 1 (C. elegans) 1 1
MIRT584694 Cep170b centrosomal protein 170B 1 3
MIRT585022 Gskip GSK3B interacting protein 1 1
MIRT585237 Zfp446 zinc finger protein 446 1 1
MIRT586099 Reep4 receptor accessory protein 4 1 2
MIRT587711 Cd300a CD300A molecule 1 2
MIRT588338 Zfp711 zinc finger protein 711 1 1
MIRT588632 Tnrc6b trinucleotide repeat containing 6b 1 3
MIRT589298 Pigh phosphatidylinositol glycan anchor biosynthesis, class H 1 1
MIRT590161 Eno2 enolase 2, gamma neuronal 1 1
MIRT592638 Lpar3 lysophosphatidic acid receptor 3 1 2
MIRT593645 Tbc1d5 TBC1 domain family, member 5 1 1
MIRT595042 Camk4 calcium/calmodulin-dependent protein kinase IV 1 1
MIRT595217 Slc16a1 solute carrier family 16 (monocarboxylic acid transporters), member 1 1 1
MIRT595451 Ptrhd1 peptidyl-tRNA hydrolase domain containing 1 1 1
MIRT595826 Fam227a family with sequence similarity 227, member A 1 1
MIRT596025 Cdk13 cyclin-dependent kinase 13 1 1
MIRT596356 Serpine1 serine (or cysteine) peptidase inhibitor, clade E, member 1 1 1
MIRT596419 Ing1 inhibitor of growth family, member 1 1 1
MIRT596513 Zfp9 zinc finger protein 9 1 1
MIRT599308 Csf1 colony stimulating factor 1 (macrophage) 1 1
MIRT603175 Trp53rk transformation related protein 53 regulating kinase B 1 1
MIRT731329 IL21R interleukin 21 receptor 1 1
MIRT733494 Gfra1 glial cell line derived neurotrophic factor family receptor alpha 1 1 0
MIRT735519 SOCS1 suppressor of cytokine signaling 1 2 0
MIRT755305 Runx2 runt related transcription factor 2 2 1
MIRT755548 SOCS3 suppressor of cytokine signaling 3 3 1
MIRT755880 NCAM1 neural cell adhesion molecule 1 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-30a Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-30a Polylysine NULL 162282 Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-30a Trypaflavine NULL NULL Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-30a Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-30a Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-30a Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-30a Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-30a 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-30a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 up-regulated
miR-30a Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miR-30a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-30a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-30a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-30a-5p Paclitaxel approved 36314 Microarray Ovarian cancer cell lines 24220856 2014 up-regulated
miR-30a-5p Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-30a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer tissue and cell line (SGC7092, SGC7091)
mmu-miR-30a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line (HCT-116)

Error report submission