pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-677 |
Genomic Coordinates | chr10: 128085286 - 128085363 |
Synonyms | Mirn677, mmu-mir-677, Mir677 |
Description | Mus musculus miR-677 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-677-5p |
Sequence | 6| UUCAGUGAUGAUUAGCUUCUGA |27 |
Evidence | Experimental |
Experiments | MPSS |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Ubap2l | ||||||||||||||||||||
Synonyms | 3110083O19Rik, 4932431F02Rik, A430103N23Rik, C77168, Nice-4, mKIAA0144 | ||||||||||||||||||||
Description | ubiquitin-associated protein 2-like | ||||||||||||||||||||
Transcript | NM_028475 | ||||||||||||||||||||
Other Transcripts | NM_001165984 , NM_001165985 , NM_001165986 , NM_001165987 , NM_001165988 , NM_001165983 , NM_153489 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Ubap2l | |||||||||||||||||||||
3'UTR of Ubap2l (miRNA target sites are highlighted) |
>Ubap2l|NM_028475|3'UTR 1 GTATTACCGTACCAACTGGGGCCTCTTCTAGCAGGCTCGAAGGCTGTGGAATAAAGTGAAATCTTTGCCCTTTAAGATCT 81 CTCACCTTAATGTGCTAATATTTTGCCCTTAAGGGGATTTCCTTATACATTCTGTGACTGGAAAGAACTACTGCAAATCT 161 TCATTTCTTCTAGAAACTGCCTCATCTACAGCACGTTTCAGGAAGTGAAAGGGGAAGGAGCTAAGGACATTTAGAAGGCA 241 AAGGACCTTGTGGGAATCTAAGCATGGTTTTAAAGGATTCTGAAGTCTCAAGCCAGCATTAGCTGCTGGCCGGCAGAACT 321 CAATCTTGGGGTCTTTTTCTCTTTGGAGGAGTATAGTAGTTCTTGTTCTCTGAGTTATGTTTTTGAGACAGTCTCACTAT 401 GTAACCCTGACTGGCCTGGAGCTTGGTGTGGAGACCAGGTTGGTCTCACATTCAGAGATCTGCCTGCTTCTACCTCTTGA 481 GTGCTAAGGTTAAAGGTTGTCAGCACTACACCCTGCCTTGCCTATTTTATGTGGCTTTGAAATGCCTACATTTTGGGAAA 561 AGAATGGATGATCTTAGAGCAAGACCTGGGGTGGGGGCATGGTGCAGTAAAAGGTTTTTGGACTTC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | C2C12 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast
HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes
... - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell. |
Article |
- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al. - Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
|
44 mmu-miR-677-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT580133 | Ubap2l | ubiquitin-associated protein 2-like | 1 | 1 | ||||||||
MIRT582833 | Itgb3 | integrin beta 3 | 1 | 4 | ||||||||
MIRT583171 | Grik3 | glutamate receptor, ionotropic, kainate 3 | 1 | 3 | ||||||||
MIRT583782 | Elovl7 | ELOVL family member 7, elongation of long chain fatty acids (yeast) | 1 | 2 | ||||||||
MIRT585951 | Sin3a | transcriptional regulator, SIN3A (yeast) | 1 | 1 | ||||||||
MIRT589768 | Iws1 | IWS1, SUPT6 interacting protein | 1 | 1 | ||||||||
MIRT591164 | Mup19 | major urinary protein 19 | 1 | 1 | ||||||||
MIRT591170 | Mup12 | major urinary protein 12 | 1 | 1 | ||||||||
MIRT591176 | Mup10 | major urinary protein 10 | 1 | 1 | ||||||||
MIRT591807 | Mup14 | major urinary protein 14 | 1 | 1 | ||||||||
MIRT592567 | Mup17 | major urinary protein 17 | 1 | 1 | ||||||||
MIRT592608 | Mup11 | major urinary protein 11 | 1 | 1 | ||||||||
MIRT593180 | Clasp1 | CLIP associating protein 1 | 1 | 1 | ||||||||
MIRT594028 | 5430427O19Rik | RIKEN cDNA 5430427O19 gene | 1 | 1 | ||||||||
MIRT595083 | Zfp516 | zinc finger protein 516 | 1 | 1 | ||||||||
MIRT595535 | Fign | fidgetin | 1 | 1 | ||||||||
MIRT595555 | Ubr3 | ubiquitin protein ligase E3 component n-recognin 3 | 1 | 1 | ||||||||
MIRT595557 | Tcte1 | t-complex-associated testis expressed 1 | 1 | 1 | ||||||||
MIRT595562 | Sptbn1 | spectrin beta, non-erythrocytic 1 | 1 | 1 | ||||||||
MIRT595569 | Nrsn1 | neurensin 1 | 1 | 1 | ||||||||
MIRT595571 | Mtf1 | metal response element binding transcription factor 1 | 1 | 1 | ||||||||
MIRT595579 | Josd1 | Josephin domain containing 1 | 1 | 1 | ||||||||
MIRT595580 | Fam101b | refilin B | 1 | 1 | ||||||||
MIRT595587 | 4930444A02Rik | protein-O-mannose kinase | 1 | 1 | ||||||||
MIRT595593 | Ago1 | argonaute RISC catalytic subunit 1 | 1 | 1 | ||||||||
MIRT595602 | Nbl1 | neuroblastoma, suppression of tumorigenicity 1 | 1 | 1 | ||||||||
MIRT595604 | March8 | membrane-associated ring finger (C3HC4) 8 | 1 | 1 | ||||||||
MIRT595625 | Nol7 | nucleolar protein 7 | 1 | 1 | ||||||||
MIRT595629 | Gnptg | N-acetylglucosamine-1-phosphotransferase, gamma subunit | 1 | 1 | ||||||||
MIRT595633 | Ednra | endothelin receptor type A | 1 | 1 | ||||||||
MIRT595649 | B3galt5 | UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 | 1 | 1 | ||||||||
MIRT595667 | Rxrb | retinoid X receptor beta | 1 | 1 | ||||||||
MIRT595743 | Ctdspl2 | CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 | 1 | 1 | ||||||||
MIRT595789 | Fignl2 | fidgetin-like 2 | 1 | 1 | ||||||||
MIRT595880 | Gid4 | GID complex subunit 4, VID24 homolog | 1 | 1 | ||||||||
MIRT595909 | Tapt1 | transmembrane anterior posterior transformation 1 | 1 | 1 | ||||||||
MIRT595919 | Trim9 | tripartite motif-containing 9 | 1 | 1 | ||||||||
MIRT595925 | Efr3a | EFR3 homolog A | 1 | 1 | ||||||||
MIRT595937 | Acmsd | amino carboxymuconate semialdehyde decarboxylase | 1 | 1 | ||||||||
MIRT595943 | B3gnt5 | UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 | 1 | 1 | ||||||||
MIRT596004 | Disp2 | dispatched RND tramsporter family member 2 | 1 | 1 | ||||||||
MIRT596008 | Ceacam1 | carcinoembryonic antigen-related cell adhesion molecule 1 | 1 | 1 | ||||||||
MIRT596167 | Ms4a15 | membrane-spanning 4-domains, subfamily A, member 15 | 1 | 1 | ||||||||
MIRT597273 | Slc25a33 | solute carrier family 25, member 33 | 1 | 1 |