miRTarBase - #MIRT580332


—
pre-miRNA Information
pre-miRNA mmu-mir-129-1   
Genomic Coordinates chr6: 29022619 - 29022691
Description Mus musculus miR-129-1 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
pre-miRNA mmu-mir-129-2   
Genomic Coordinates chr2: 94241364 - 94241453
Description Mus musculus miR-129-2 stem-loop
Comment The miRNA from the 5' arm of this precursor was verified by cloning in mouse .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-129-5p
Sequence 15| CUUUUUGCGGUCUGGGCUUGC |35
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Tnfaip1   
Synonyms Bacurd2, Edp-1, Edp1, Tnfip1
Description tumor necrosis factor, alpha-induced protein 1 (endothelial)
Transcript NM_001159392   
Other Transcripts NM_009395   
Expression
Putative miRNA Targets on Tnfaip1
3'UTR of Tnfaip1
(miRNA target sites are highlighted)		 
>Tnfaip1|NM_001159392|3'UTR
   1 TGAGACCCTTAAGAAATCGGGGCACAAGAAGTCCTGTCTGCCACCCTGTGGAACGTACCCATTGGCCACCCTATGCTGCT
  81 CCTGCTAGCTGGGAGCCTGCTCTAGTATGTACAGGTGACAGCCCTGCTTGGGAGGTTGGGGAGCTGAGAGAGGGAAGGCC
 161 ACATTGTCTTGGCTGGCCCCCCTCCCCCCAGCACTTCCAGATGCCACCCCACTTCCTGCCAATAAGGAGCTACTTCTGCT
 241 CTAGGGTGAGTGCACTGATTTCCCACCTCCTGCCAAGAATACCCCCTGGCCCTTGGCTGAGTGCCCCTTTCTTCTGAAGA
 321 GCTCCTTTAGCTCCTCAGCTGAGGCCCACGAGAACAGCTTTGTTCTAGGGGAAAGGAGGCTTCTGGTGCTGCGAGGACCC
 401 AATTTTGAACAGAAAAAGTGGCCTTTTTTTTTCCTAAGGTGTTTAAACATTGGTATAACCTGGATTTTTGTTTGTTTTTA
 481 AATCTAGATGTTAGCATGGCCGTACCTATAATCCCAGCTATGGAGAAGCCGAGGTGGGATAACATGTTCTAGGCTAGCCT
 561 GGACAACATAGCAAGGCCCTCAATATAAAATTTTAAAAAGGGGGCTCACCTAGCAAGAGTGAGGCCCTGGGCTCAATCTC
 641 CAGTACTGCCACACTCACTAGGTATCTACGAAATGACTAGTTTTTAGTCTGGGGGGAAAGCTAGGACTAAGCAGAGTGCC
 721 AGGACCCCACCTAGTAGGCACACACTCACACACTCACTCCACCCTTTTCAGTATCCTAGGACCCATCTTTAAAGCACTTT
 801 GTATGTCTATCATTCAGGGGAATCTATTCTGCCTTGACCCAAAGCTTTTTCTGACACTGATCCCCTCCTGCACAATCTTA
 881 AGGAAAGGCTGAGACAGGAGGATCACAAGTTTGAGACCAGCCTGTGCTATGTAGTTAAAAGTTCCAGGCCAGCCTGGGCT
 961 ACATAGGCTTTGTTTCAAAAAAAAAAAAAAAAAAAAAAGTAGACTGACCAGCTTTGGCTTGTCAGCCTGACTACCCAAAG
1041 AATACCAAGAGGGAAAGGACGTCCAAGTTGAAAATGGTTTTAATAGCATCCTGTGGGGAAAGGGTAGGGTCACATCACTG
1121 ACTCAGACTTAACAGGATTCTTTGGTGTGAGCCTCATACTTGGGTATGTTCAGCTCTAAGACACAGATGTGCTGCAGCCC
1201 CTGATACTATGTCTCAGTTTATGTCCTGGTTCTGCCTAGTGATGCATCTCCAAATACATAGTAACTAGGACCACCTAAGC
1281 CTTTGAAAGACCTTTCTTCTGGGTCACTGACCACGGATGTACCAAGATCTAGACCTGGTGTCAATTCTTCCTTTGCGCTT
1361 TGGTTTCCCTCCCTTTCTTTGTTGGGACTGGCTCTCTTACCTGGATTCTATCCAGAGGAATGTTGTCACTGGAGGGGGCT
1441 GTTTGTAAGCCTAAGGAAGTGTGTACCCATCAACAGTGCCCAAGAAGGGCCACAGATTATCAGCTGTATCCCTTGACTAC
1521 TCTTATGATTGCCACATGGGCACACAAAGGCTCACCTCTTAGAGCCTATGGGCAGATGCCAAGCCCAGGGTTGGGCTCTC
1601 ACAAGGATCTAGCCTGACAGGGCAAGGGGAAATGGGAAATGTGACTTAATAATCAGGCATGTTATGTTAATCACGATCTT
1681 GAATGTATAAATAGCTCTAAGATGCTTGGGTCAGGCACCTTAGTGACGAGCAACTATTAGTTCGTCCAGATCTCGCTGGA
1761 ACTAAGATGACAATCCAACTTTTTTGGCCAAATAGAGGCTTTGGCTTTCAGTCTTTCCCACAGACTTTGGAATGTGACAG
1841 CATGAGGCCACCAATCTGTTTTCTCAGCTGTCCCCTAGAAGCCTTTAACACTCAGATTCTCAGACCCCTGCGGTGTTTCC
1921 AGTTTGTCTCTTTACCGCCACACCCCCTTTAGCCTCCATGAGGCGCTTTGACATCCATCTCCTCTGCTGTTCAGTGCTGT
2001 CTAGTCATGGGCTGAGGAAACATAGCAGGAGTCCCGGGTTGGGCATTCATCTTCTTTGACTGAAAATTTCTCCTTGGTTT
2081 AAGGAAATAATACTGAAGTGATCTGGACTCGTGAGATTTACCAGCCCTGTCCTAAAGGAGTTGTAGCAGGATGGGTTTTT
2161 TGATCACAGGCAGTCCAGGGGACTTAAACATAAAACATGCATGAGGGTCAGACTGGACGCTGCTCACAAACACCAGCTGT
2241 GTGCTGTTGAACCTGGGACATGTGACTGGTTGGCCTGAAGGGTAACACAGGTTCTGGCAGGAAAGAATGTGCCCTTTACT
2321 ACATACCTGCGGTCTCAGTTGCTTACCTTAAGTGATGGAAGTAAACACTAACTTCTAATAAAGTTGTTTTACACTGCTGA
2401 GCCATGTTTCCAGTGAGCAGAGCCTGGCCAGCTCACAGCTGTGGGCTCAGTTCTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgUUCGGGUCUGGCGUUUUUc 5'
            ::||:||  : ||||:|: 
Target 5' ggGGGCTCACCTAGCAAGAGt 3'
 600 - 620 123.00 -11.60
2 
miRNA  3' cgUUCGGGUCUGGCGUUUUUc 5'
            |:||:: | :: |||||| 
Target 5' atAGGCTTTG-TTTCAAAAAa 3'
 963 - 982 122.00 -5.84
3 
miRNA  3' cguUCGGGUCUGG---CGUUUUUc 5'
             | | |||:::   |||::|| 
Target 5' ggtAACACAGGTTCTGGCAGGAAa 3'
 2281 - 2304 118.00 -12.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgUUCGGGUCUGGCGUUUUUc 5'
            |:||:: | :: |||||| 
Target 5' auAGGCUUUG-UUUCAAAAAa 3'
 		3 - 22
Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
CLIP-seq Support 1 for dataset GSM4656410
Method / RBP HITS-CLIP / AGO
Cell line / Condition mouse liver / e185 rep2
Location of target site NM_009395 | 3UTR | UUUCAAAAAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE153876
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1385342
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_GM_Ago2_CLIP-Seq_myoblast
Location of target site NM_009395 | 3UTR | GCUUUGUUUCAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1385343
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_DM_Ago2_CLIP-Seq_myotubes
Location of target site NM_009395 | 3UTR | ACAUAGGCUUUGUUUCAAAAAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
350 mmu-miR-129-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT415357 Map3k1 mitogen-activated protein kinase kinase kinase 1 2 2
MIRT417807 Cbx6 chromobox 6 2 2
MIRT576977 Triml1 tripartite motif family-like 1 2 2
MIRT576990 Pknox1 Pbx/knotted 1 homeobox 2 4
MIRT576994 Mrpl17 mitochondrial ribosomal protein L17 2 2
MIRT577003 Gpx5 glutathione peroxidase 5 2 2
MIRT577024 Fndc3b fibronectin type III domain containing 3B 2 4
MIRT577372 Ybey ybeY metallopeptidase 2 2
MIRT577527 Tirap toll-interleukin 1 receptor (TIR) domain-containing adaptor protein 2 4
MIRT577532 Timm17b translocase of inner mitochondrial membrane 17b 2 4
MIRT577614 Stx8 syntaxin 8 2 4
MIRT577649 Smyd4 SET and MYND domain containing 4 2 2
MIRT578346 Lsm12 LSM12 homolog 2 4
MIRT578383 Kremen2 kringle containing transmembrane protein 2 2 2
MIRT578816 Fkbp6 FK506 binding protein 6 2 6
MIRT578986 Daxx Fas death domain-associated protein 2 4
MIRT578999 Cytip cytohesin 1 interacting protein 2 4
MIRT579175 Cd3eap CD3E antigen, epsilon polypeptide associated protein 2 2
MIRT579562 Oacyl O-acyltransferase like 1 1
MIRT579610 4930430F08Rik RIKEN cDNA 4930430F08 gene 2 2
MIRT579647 2510049J12Rik makorin, ring finger protein 2, opposite strand 2 4
MIRT579654 2010012O05Rik BLOC-1 related complex subunit 7 2 6
MIRT579679 Ccdc167 coiled-coil domain containing 167 1 1
MIRT579687 Zzz3 zinc finger, ZZ domain containing 3 2 4
MIRT579798 Zfp280d zinc finger protein 280D 2 2
MIRT579949 Xpo7 exportin 7 2 4
MIRT580023 Whsc1 nuclear receptor binding SET domain protein 2 2 4
MIRT580332 Tnfaip1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 2 2
MIRT580338 Tmod1 tropomodulin 1 2 2
MIRT580489 Tgoln1 trans-golgi network protein 2 2
MIRT580780 Sp3 trans-acting transcription factor 3 2 4
MIRT581221 Runx2 runt related transcription factor 2 2 2
MIRT581224 Runx1t1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 2 4
MIRT581264 Rragb Ras-related GTP binding B 2 2
MIRT581399 Rbm47 RNA binding motif protein 47 2 4
MIRT581985 Pcnp PEST proteolytic signal containing nuclear protein 2 2
MIRT582039 Otud7b OTU domain containing 7B 2 4
MIRT582362 Mtf2 metal response element binding transcription factor 2 2 2
MIRT582419 Mmp11 matrix metallopeptidase 11 2 2
MIRT582478 Med13 mediator complex subunit 13 2 2
MIRT582814 Jdp2 Jun dimerization protein 2 2 2
MIRT582931 Il11 interleukin 11 2 4
MIRT583199 Grb14 growth factor receptor bound protein 14 2 2
MIRT583261 Gnaz guanine nucleotide binding protein, alpha z subunit 2 2
MIRT583385 G3bp2 GTPase activating protein (SH3 domain) binding protein 2 2 2
MIRT583670 Fam160b1 family with sequence similarity 160, member B1 2 2
MIRT583679 Fam126b family with sequence similarity 126, member B 2 4
MIRT583681 Amer1 APC membrane recruitment 1 1 1
MIRT583843 Efna5 ephrin A5 2 4
MIRT584076 Ctbp2 C-terminal binding protein 2 2 4
MIRT584187 Cpeb3 cytoplasmic polyadenylation element binding protein 3 2 4
MIRT584339 Cdyl2 chromodomain protein, Y chromosome-like 2 2 2
MIRT584386 Cdh12 cadherin 12 2 2
MIRT584490 Camta1 calmodulin binding transcription activator 1 2 2
MIRT584511 Cadm2 cell adhesion molecule 2 2 4
MIRT584561 Brd4 bromodomain containing 4 2 2
MIRT584710 Atxn1 ataxin 1 2 2
MIRT584926 Agl amylo-1,6-glucosidase, 4-alpha-glucanotransferase 2 2
MIRT585045 Ptchd4 patched domain containing 4 1 2
MIRT585090 Zmat1 zinc finger, matrin type 1 2 2
MIRT585122 Zfp933 zinc finger protein 933 2 2
MIRT585460 Ube2c ubiquitin-conjugating enzyme E2C 2 4
MIRT585531 Trim39 tripartite motif-containing 39 2 2
MIRT585580 Tpm3 tropomyosin 3, gamma 2 2
MIRT585640 Tmem50a transmembrane protein 50A 2 2
MIRT585775 Spc24 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) 2 2
MIRT585864 Slc23a1 solute carrier family 23 (nucleobase transporters), member 1 2 2
MIRT585898 Slc17a8 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 2 2
MIRT586597 Mob3c MOB kinase activator 3C 1 1
MIRT586634 Mettl2 methyltransferase like 2 2 2
MIRT586644 Med16 mediator complex subunit 16 2 2
MIRT586751 Kif1c kinesin family member 1C 2 4
MIRT586782 Jakmip1 janus kinase and microtubule interacting protein 1 2 2
MIRT586872 Hyal1 hyaluronoglucosaminidase 1 2 2
MIRT586967 Gprc5c G protein-coupled receptor, family C, group 5, member C 2 2
MIRT587082 Glrx2 glutaredoxin 2 (thioltransferase) 2 2
MIRT587170 Gad2 glutamic acid decarboxylase 2 2 4
MIRT587334 Egfr epidermal growth factor receptor 2 2
MIRT587934 Atpbd4 diphthamine biosynthesis 6 2 2
MIRT587947 Asph aspartate-beta-hydroxylase 2 4
MIRT587974 Arpc4 actin related protein 2/3 complex, subunit 4 2 2
MIRT588081 Agtrap angiotensin II, type I receptor-associated protein 2 2
MIRT588092 Afg3l1 AFG3-like AAA ATPase 1 2 4
MIRT588135 A830018L16Rik RIKEN cDNA A830018L16 gene 2 2
MIRT588348 Zfp568 zinc finger protein 568 2 2
MIRT588382 Zfp131 zinc finger protein 131 2 2
MIRT588453 Ybx1 Y box protein 1 2 2
MIRT588755 Synj1 synaptojanin 1 2 2
MIRT588762 Stxbp5 syntaxin binding protein 5 (tomosyn) 2 4
MIRT589047 Rfx3 regulatory factor X, 3 (influences HLA class II expression) 2 2
MIRT589148 Rad18 RAD18 E3 ubiquitin protein ligase 2 2
MIRT589224 Prdm16 PR domain containing 16 2 2
MIRT589288 Pik3c2a phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 2 2
MIRT589417 Nras neuroblastoma ras oncogene 2 4
MIRT589442 Ncl nucleolin 2 2
MIRT589528 Mob4 MOB family member 4, phocein 1 1
MIRT589562 Mau2 MAU2 sister chromatid cohesion factor 2 4
MIRT589580 Magt1 magnesium transporter 1 2 4
MIRT589725 Kif11 kinesin family member 11 2 2
MIRT589752 Jhdm1d lysine (K)-specific demethylase 7A 2 2
MIRT589850 Hif1a hypoxia inducible factor 1, alpha subunit 2 2
MIRT589963 Gabpb2 GA repeat binding protein, beta 2 2 4
MIRT589997 Fsd1l fibronectin type III and SPRY domain containing 1-like 2 4
MIRT590506 Btg1 B cell translocation gene 1, anti-proliferative 2 2
MIRT590634 Arhgef9 CDC42 guanine nucleotide exchange factor (GEF) 9 2 2
MIRT590768 Crebrf CREB3 regulatory factor 1 1
MIRT590773 5730455P16Rik RIKEN cDNA 5730455P16 gene 2 2
MIRT590782 Epg5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT590981 Slc7a10 solute carrier family 7 (cationic amino acid transporter, y+ system), member 10 2 4
MIRT591495 Apba2 amyloid beta (A4) precursor protein-binding, family A, member 2 2 2
MIRT592320 Dbndd2 dysbindin (dystrobrevin binding protein 1) domain containing 2 2 2
MIRT593576 Zyg11b zyg-ll family member B, cell cycle regulator 2 2
MIRT593584 Zfp329 zinc finger protein 329 2 2
MIRT593585 Zbtb21 zinc finger and BTB domain containing 21 1 1
MIRT593587 Zfp26 zinc finger protein 26 2 2
MIRT593590 Yipf5 Yip1 domain family, member 5 2 2
MIRT593605 Veph1 ventricular zone expressed PH domain-containing 1 2 2
MIRT593606 Vcan versican 2 2
MIRT593609 Usp2 ubiquitin specific peptidase 2 2 2
MIRT593614 Ubxn2b UBX domain protein 2B 2 2
MIRT593637 Tcf23 transcription factor 23 2 2
MIRT593649 Stx3 syntaxin 3 2 2
MIRT593653 Ssbp3 single-stranded DNA binding protein 3 2 2
MIRT593658 Spen SPEN homolog, transcriptional regulator (Drosophila) 2 2
MIRT593668 Smarcc1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 2 2
MIRT593670 Slc7a12 solute carrier family 7 (cationic amino acid transporter, y+ system), member 12 2 2
MIRT593677 Slc1a3 solute carrier family 1 (glial high affinity glutamate transporter), member 3 2 2
MIRT593685 Sco1 SCO1 cytochrome c oxidase assembly protein 2 2
MIRT593700 Rspry1 ring finger and SPRY domain containing 1 2 2
MIRT593705 Rprd1b regulation of nuclear pre-mRNA domain containing 1B 2 2
MIRT593715 Pum2 pumilio RNA-binding family member 2 2 2
MIRT593720 Prokr2 prokineticin receptor 2 2 2
MIRT593721 Prkd3 protein kinase D3 2 2
MIRT593733 Ppih peptidyl prolyl isomerase H 2 2
MIRT593738 Pou2f2 POU domain, class 2, transcription factor 2 2 2
MIRT593739 Pld5 phospholipase D family, member 5 2 2
MIRT593748 Pgm2l1 phosphoglucomutase 2-like 1 2 2
MIRT593755 Pdzd2 PDZ domain containing 2 2 2
MIRT593761 Pax2 paired box 2 2 2
MIRT593769 Nuak2 NUAK family, SNF1-like kinase, 2 2 2
MIRT593777 Nfic nuclear factor I/C 2 2
MIRT593781 Ndor1 NADPH dependent diflavin oxidoreductase 1 2 2
MIRT593789 Nanos1 nanos homolog 1 (Drosophila) 2 2
MIRT593791 Mthfd2 methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase 2 2
MIRT593792 Ms4a6b membrane-spanning 4-domains, subfamily A, member 6B 2 2
MIRT593812 Lsm11 U7 snRNP-specific Sm-like protein LSM11 2 2
MIRT593814 Lrrc8e leucine rich repeat containing 8 family, member E 2 2
MIRT593817 Lpl lipoprotein lipase 2 2
MIRT593820 Limd1 LIM domains containing 1 2 2
MIRT593822 Lig4 ligase IV, DNA, ATP-dependent 2 2
MIRT593827 Klk9 kallikrein related-peptidase 9 2 2
MIRT593828 Klhl31 kelch-like 31 2 2
MIRT593837 Kdsr 3-ketodihydrosphingosine reductase 2 2
MIRT593839 Kdm5a lysine (K)-specific demethylase 5A 2 2
MIRT593840 Kcnj15 potassium inwardly-rectifying channel, subfamily J, member 15 2 2
MIRT593851 Hcn1 hyperpolarization-activated, cyclic nucleotide-gated K+ 1 2 2
MIRT593861 Gm15455 predicted gene 15455 2 2
MIRT593863 Trabd2b TraB domain containing 2B 1 1
MIRT593864 Glul glutamate-ammonia ligase (glutamine synthetase) 2 2
MIRT593872 Gabra1 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 2 2
MIRT593876 Fyn Fyn proto-oncogene 2 2
MIRT593880 Fam178a SMC5-SMC6 complex localization factor 2 2 2
MIRT593883 Fam172a family with sequence similarity 172, member A 2 2
MIRT593896 Edaradd EDAR (ectodysplasin-A receptor)-associated death domain 2 2
MIRT593901 Dlgap4 discs, large homolog-associated protein 4 (Drosophila) 2 2
MIRT593904 Dcaf6 DDB1 and CUL4 associated factor 6 2 2
MIRT593916 D630003M21Rik RIKEN cDNA D630003M21 gene 2 2
MIRT593920 D16Ertd472e DNA segment, Chr 16, ERATO Doi 472, expressed 2 2
MIRT593934 Cybb cytochrome b-245, beta polypeptide 2 2
MIRT593957 Cox10 cytochrome c oxidase assembly protein 10 2 2
MIRT593959 Col4a1 collagen, type IV, alpha 1 2 2
MIRT593965 Clpb ClpB caseinolytic peptidase B 2 2
MIRT593969 Cdh4 cadherin 4 2 2
MIRT593974 Cdc14b CDC14 cell division cycle 14B 2 2
MIRT593978 Car8 carbonic anhydrase 8 2 2
MIRT593979 Camkk2 calcium/calmodulin-dependent protein kinase kinase 2, beta 2 2
MIRT593980 C230081A13Rik pseudopodium-enriched atypical kinase 1 2 2
MIRT593983 Bmp2 bone morphogenetic protein 2 2 2
MIRT593986 Bet1l Bet1 golgi vesicular membrane trafficking protein like 2 2
MIRT593987 Bean1 brain expressed, associated with Nedd4, 1 2 2
MIRT594003 Fam211b leucine rich repeat containing 75B 1 1
MIRT594004 Adrb1 adrenergic receptor, beta 1 2 2
MIRT594005 Acot2 acyl-CoA thioesterase 2 2 2
MIRT594014 Ifitm10 interferon induced transmembrane protein 10 1 1
MIRT594043 1810041L15Rik RIKEN cDNA 1810041L15 gene 2 2
MIRT594046 1200014J11Rik nuclear cap binding subunit 3 2 2
MIRT594056 Zfhx3 zinc finger homeobox 3 2 2
MIRT594069 Trio triple functional domain (PTPRF interacting) 2 2
MIRT594087 Rnf11 ring finger protein 11 2 2
MIRT594090 Pdik1l PDLIM1 interacting kinase 1 like 2 2
MIRT594091 Nid1 nidogen 1 2 2
MIRT594102 Mgll monoglyceride lipase 2 2
MIRT594110 Hoxc10 homeobox C10 2 2
MIRT594112 Hoxb3 homeobox B3 2 2
MIRT594114 Hjurp Holliday junction recognition protein 2 2
MIRT594118 Foxq1 forkhead box Q1 2 2
MIRT594122 Fam63b MINDY lysine 48 deubiquitinase 2 2 2
MIRT594123 Dst dystonin 2 2
MIRT594133 Ctdspl2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 2 2
MIRT594142 Chst1 carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 2 2
MIRT594145 Ccnd1 cyclin D1 2 2
MIRT594147 Casz1 castor zinc finger 1 2 2
MIRT594162 Epb4.1l5 erythrocyte membrane protein band 4.1 like 5 2 2
MIRT594165 Cep97 centrosomal protein 97 2 2
MIRT594169 Vdr vitamin D (1,25-dihydroxyvitamin D3) receptor 2 2
MIRT594184 Irak1 interleukin-1 receptor-associated kinase 1 2 2
MIRT594190 Zic4 zinc finger protein of the cerebellum 4 2 2
MIRT594194 Zfp641 zinc finger protein 641 2 2
MIRT594200 Zfp120 zinc finger protein 120 2 2
MIRT594210 Uhrf1bp1l UHRF1 (ICBP90) binding protein 1-like 2 2
MIRT594215 Ube2k ubiquitin-conjugating enzyme E2K 2 2
MIRT594220 Trove2 TROVE domain family, member 2 2 2
MIRT594224 Tpp1 tripeptidyl peptidase I 2 2
MIRT594229 Tm9sf4 transmembrane 9 superfamily protein member 4 2 2
MIRT594236 Tfb2m transcription factor B2, mitochondrial 2 2
MIRT594248 Sorcs3 sortilin-related VPS10 domain containing receptor 3 2 2
MIRT594277 Ptprj protein tyrosine phosphatase, receptor type, J 2 2
MIRT594278 Ptges3 prostaglandin E synthase 3 2 2
MIRT594282 Prf1 perforin 1 (pore forming protein) 2 2
MIRT594286 Pphln1 periphilin 1 2 2
MIRT594289 Ppara peroxisome proliferator activated receptor alpha 2 2
MIRT594291 Pms2 PMS1 homolog2, mismatch repair system component 2 2
MIRT594293 Pmepa1 prostate transmembrane protein, androgen induced 1 2 2
MIRT594302 Opcml opioid binding protein/cell adhesion molecule-like 2 2
MIRT594305 Ocrl OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT594309 Nr3c1 nuclear receptor subfamily 3, group C, member 1 2 2
MIRT594316 Nr2c1 nuclear receptor subfamily 2, group C, member 1 2 2
MIRT594319 Nos3 nitric oxide synthase 3, endothelial cell 2 2
MIRT594327 Nav1 neuron navigator 1 2 2
MIRT594349 Mak male germ cell-associated kinase 2 2
MIRT594351 Lrrc58 leucine rich repeat containing 58 2 2
MIRT594368 Kif21a kinesin family member 21A 2 2
MIRT594371 Kcnc3 potassium voltage gated channel, Shaw-related subfamily, member 3 2 2
MIRT594376 Jkamp JNK1/MAPK8-associated membrane protein 2 2
MIRT594381 Isg15 ISG15 ubiquitin-like modifier 2 2
MIRT594400 Ing5 inhibitor of growth family, member 5 2 2
MIRT594405 Hs6st2 heparan sulfate 6-O-sulfotransferase 2 2 2
MIRT594411 Hao1 hydroxyacid oxidase 1, liver 2 2
MIRT594419 Gjd4 gap junction protein, delta 4 2 2
MIRT594421 Gdf3 growth differentiation factor 3 2 2
MIRT594445 Fam161b family with sequence similarity 161, member B 2 2
MIRT594450 Amer2 APC membrane recruitment 2 1 1
MIRT594458 Ern2 endoplasmic reticulum (ER) to nucleus signalling 2 2 2
MIRT594474 Mb21d1 Mab-21 domain containing 1 1 1
MIRT594475 Dpy19l1 dpy-19-like 1 (C. elegans) 2 2
MIRT594481 Diexf digestive organ expansion factor homolog (zebrafish) 2 2
MIRT594489 Dcx doublecortin 2 2
MIRT594491 Cspg4 chondroitin sulfate proteoglycan 4 2 2
MIRT594502 Clcn3 chloride channel, voltage-sensitive 3 2 2
MIRT594506 Cdadc1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT594512 Ccdc71 coiled-coil domain containing 71 2 2
MIRT594515 Ccdc11 cilia and flagella associated protein 53 2 2
MIRT594527 BC003965 cDNA sequence BC003965 2 2
MIRT594529 BC003331 cDNA sequence BC003331 2 2
MIRT594531 B3galt1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 2 2
MIRT594534 Auts2 autism susceptibility candidate 2 2 2
MIRT594537 Atxn3 ataxin 3 2 2
MIRT594553 Angel2 angel homolog 2 2 2
MIRT594561 Nyap2 neuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2 1 1
MIRT594562 Soga3 SOGA family member 3 1 1
MIRT594564 4931406P16Rik RIKEN cDNA 4931406P16 gene 2 2
MIRT594572 1600029D21Rik placenta expressed transcript 1 2 2
MIRT594579 Znrf1 zinc and ring finger 1 2 2
MIRT594580 Zmat3 zinc finger matrin type 3 2 2
MIRT594590 Tectb tectorin beta 2 2
MIRT594609 Pak6 p21 protein (Cdc42/Rac)-activated kinase 6 2 2
MIRT594612 Ncoa1 nuclear receptor coactivator 1 2 2
MIRT594655 Lmna lamin A 2 2
MIRT594656 Itgb4 integrin beta 4 2 2
MIRT594659 Ikzf1 IKAROS family zinc finger 1 2 2
MIRT594663 Hars histidyl-tRNA synthetase 2 2
MIRT594665 Fnip1 folliculin interacting protein 1 2 2
MIRT594681 Celf2 CUGBP, Elav-like family member 2 2 2
MIRT594687 Bicd1 bicaudal D homolog 1 (Drosophila) 2 2
MIRT594695 Asxl2 additional sex combs like 2 (Drosophila) 2 2
MIRT594699 Apbb2 amyloid beta (A4) precursor protein-binding, family B, member 2 2 2
MIRT594707 Ammecr1l AMME chromosomal region gene 1-like 2 2
MIRT594731 Zfp871 zinc finger protein 871 2 2
MIRT594743 Zfp263 zinc finger protein 263 2 2
MIRT594760 Tspyl5 testis-specific protein, Y-encoded-like 5 2 2
MIRT594765 Tmpo thymopoietin 2 2
MIRT594783 Srrm1 serine/arginine repetitive matrix 1 2 2
MIRT594793 Slc16a6 solute carrier family 16 (monocarboxylic acid transporters), member 6 2 2
MIRT594800 Sel1l sel-1 suppressor of lin-12-like (C. elegans) 2 2
MIRT594826 Pds5b PDS5 cohesin associated factor B 2 2
MIRT594830 Parp3 poly (ADP-ribose) polymerase family, member 3 2 2
MIRT594831 Pacsin1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT594834 Osbp oxysterol binding protein 2 2
MIRT594845 Npm3 nucleoplasmin 3 2 2
MIRT594861 Naaa N-acylethanolamine acid amidase 2 2
MIRT594886 Kcnma1 potassium large conductance calcium-activated channel, subfamily M, alpha member 1 2 2
MIRT594888 Irg1 aconitate decarboxylase 1 2 2
MIRT594890 Ildr2 immunoglobulin-like domain containing receptor 2 2 2
MIRT594904 Homer1 homer scaffolding protein 1 2 2
MIRT594908 Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 2 2
MIRT594928 Gm13611 60S ribosomal protein L36 pseudogene 2 2
MIRT594938 Foxp1 forkhead box P1 2 2
MIRT594978 Enpp3 ectonucleotide pyrophosphatase/phosphodiesterase 3 2 2
MIRT594986 Dtna dystrobrevin alpha 2 2
MIRT594992 Dapk1 death associated protein kinase 1 2 2
MIRT595005 Csnk1g1 casein kinase 1, gamma 1 2 2
MIRT595011 Cpox coproporphyrinogen oxidase 2 2
MIRT595018 Col8a1 collagen, type VIII, alpha 1 2 2
MIRT595027 Cflar CASP8 and FADD-like apoptosis regulator 2 2
MIRT595051 Bace1 beta-site APP cleaving enzyme 1 2 4
MIRT595111 Sgms1 sphingomyelin synthase 1 2 2
MIRT595133 Lrrc4c leucine rich repeat containing 4C 2 2
MIRT595135 Lpin1 lipin 1 2 2
MIRT595138 Itgb6 integrin beta 6 2 2
MIRT595150 Dusp10 dual specificity phosphatase 10 2 2
MIRT595157 Chic1 cysteine-rich hydrophobic domain 1 2 2
MIRT595162 Bcl11b B cell leukemia/lymphoma 11B 2 2
MIRT595163 Bach2 BTB and CNC homology, basic leucine zipper transcription factor 2 2 2
MIRT595188 Tnpo3 transportin 3 2 2
MIRT595277 Map1a microtubule-associated protein 1 A 1 1
MIRT595397 Atg10 autophagy related 10 2 4
MIRT595481 Rnf152 ring finger protein 152 2 2
MIRT595482 Rell1 RELT-like 1 2 2
MIRT595544 Cnih4 cornichon family AMPA receptor auxiliary protein 4 2 2
MIRT595560 Sstr1 somatostatin receptor 1 2 2
MIRT595583 Cr2 complement receptor 2 2 2
MIRT595696 Krt24 keratin 24 2 2
MIRT595760 P4ha1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide 2 2
MIRT595782 Hoxb1 homeobox B1 2 2
MIRT595799 Cp ceruloplasmin 2 2
MIRT595859 Phactr3 phosphatase and actin regulator 3 2 2
MIRT595910 Plekhm3 pleckstrin homology domain containing, family M, member 3 2 2
MIRT595923 Fbxl18 F-box and leucine-rich repeat protein 18 2 2
MIRT595926 E2f2 E2F transcription factor 2 2 2
MIRT595951 Slco3a1 solute carrier organic anion transporter family, member 3a1 2 2
MIRT596014 Cdk13 cyclin-dependent kinase 13 2 2
MIRT596105 Slamf1 signaling lymphocytic activation molecule family member 1 2 2
MIRT596120 Rnf170 ring finger protein 170 2 2
MIRT596126 Rhoj ras homolog family member J 2 2
MIRT596150 Peg3 paternally expressed 3 2 2
MIRT596173 Mrpl19 mitochondrial ribosomal protein L19 2 2
MIRT596192 Itga9 integrin alpha 9 2 2
MIRT596415 Lpp LIM domain containing preferred translocation partner in lipoma 2 2
MIRT596441 Nrxn1 neurexin I 2 2
MIRT596498 Zfp935 zinc finger protein 935 2 2
MIRT596936 Tnrc6a trinucleotide repeat containing 6a 2 2
MIRT596987 Tmcc3 transmembrane and coiled coil domains 3 2 2
MIRT599313 Csf1 colony stimulating factor 1 (macrophage) 2 2
MIRT599504 Ccdc32 coiled-coil domain containing 32 2 2
MIRT599684 Arl16 ADP-ribosylation factor-like 16 2 2
MIRT600164 Zadh2 zinc binding alcohol dehydrogenase, domain containing 2 2 2
MIRT600962 Dusp8 dual specificity phosphatase 8 2 2
MIRT601200 Arid3a AT rich interactive domain 3A (BRIGHT-like) 2 2
MIRT606138 Tmppe transmembrane protein with metallophosphoesterase domain 2 2
MIRT606401 Gm5494 exocrine gland secreted peptide 6 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-129 Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-129 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-129 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 up-regulated
miR-129-5p Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-129-5p Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-129-5p Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR thyroid cancer cells 21946411 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-129-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer tissue and cell line (HCT-116)
mmu-miR-129-5p Decitabine 451668 approved sensitive Low Gastric Cancer tissue and cell line (SGC7901)
mmu-miR-129-5p Doxorubicin 31703 NSC123127 approved sensitive Low Gastric Cancer tissue and cell line (SGC7901)
mmu-miR-129-5p Vincristine 5978 approved sensitive Low Gastric Cancer tissue and cell line (SGC7901)

Error report submission