miRTarBase - #MIRT580534


—
pre-miRNA Information
pre-miRNA mmu-mir-374b   
Genomic Coordinates chrX: 103573060 - 103573154
Description Mus musculus miR-374b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-374b-5p
Sequence 22| AUAUAAUACAACCUGCUAAGUG |43
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Tead3   
Synonyms DTEF-1, ETFR-1, TEAD-3, TEF-5, Tcf13r2
Description TEA domain family member 3
Transcript NM_001098226   
Other Transcripts NM_011566   
Expression
Putative miRNA Targets on Tead3
3'UTR of Tead3
(miRNA target sites are highlighted)		 
>Tead3|NM_001098226|3'UTR
   1 CCAGCCCTCGACCTCCACAGGATGCAAGGCGGACATCCTCCACACACCTGCCTGCCTGGTCTTCCCGTGTGGGTTGGGGG
  81 ACCTAGCCCAGCCCCCCTGGGTTTCAGGCTGGGACCCAGGCTGCCTCCCTGGCTCCAGCACACATGCTCCCTGCCACTGT
 161 TCTGCGCTTTACTGGAGAGAAGAGGGCTCCACGGTGGGGTGGCTTGCTTGGGCACTGAGCCACAGATGACCAGGCTCCAC
 241 CTGGCCTCAAGTGACACCAGAATTGTACCATGGAGGACACCTTGGGGCTTAGTGTGTGGTTGCTGGCCCCTAGGGGAATG
 321 AATGTGCTGGGCAGGTGAGGGTTGCATTGAGACTGGGGAAAGGCAGCTTGCAAGGAGGCCCTGGTACAAGGTGTCAGGTT
 401 GGGGAGGTTGAGAAGGGCCCACACTTCTTTGTACCTTCTGGGTACCAGTCTGTTCCCAGGTCCCTTACCCAGCAAGTTTG
 481 GGTCTCCCATATCAGACAATGTGCCAAGATGGAGGCCCACAGAAGTGGACGGAGGGAGCTGGGGCTGGTTCAGCTACCTC
 561 CCTAGCAGAGCTGCCTATGGGGCGGGGAAGGGGCTCTGCTGGGCTGAAGCCTAGACAGGGCTCTATTTCCTGTTCCCCCC
 641 AGCATACCAGCCACTAGCGCCCCCCCCCCCCCCCGCCCTCTTCTGTGTCCTGAAGACAGGTGGCAGGGAACAGGAGGCTG
 721 CCTCTGCCTTCTCCACATCCAGGTCCCAAGGTCACCTGGGTATTTATGAGTTTCAAATGAAGTACTGTGCCCCCAATCCA
 801 GCCCGAGCTTCCGGAAGGTTTTCGCCATTGCTCAGGCCACCTCCAAACCCCACGTAGGTTTTATAACATGTATTATATAT
 881 ATATATTTTTGTGTATTTTTAAAATCCAGCTGTGATGGGCTACATCATAAATGGCTCAAGGCAGGGGCCACTCAAGGCCT
 961 GGCTCCTGCTTTAAAGAAAAAAATTAAAAAGCTGTTTCTGGGTCAAGACAGTTGTGCCATATGCAACCTTGTACCCTACC
1041 TAGTCAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guGAAUCGUCCAACAUAAUAUa 5'
            :||| :|   ||||||||| 
Target 5' gtTTTA-TAACATGTATTATAt 3'
 858 - 878 155.00 -7.20
2 
miRNA  3' guGAAUC-GU-CCAACAUAAuaua 5'
            | ||| || || | ||||    
Target 5' agCCTAGACAGGGCTCTATTtcct 3'
 608 - 631 100.00 -5.96
3 
miRNA  3' guGA-AUCGUCCAACAUAAUAUa 5'
            || |: ::|| |  || ||| 
Target 5' agCTGTGATGGGCTACATCATAa 3'
 908 - 930 92.00 -5.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gugaaucguccaACAUAAUAUa 5'
                      ||||||||| 
Target 5' -----------aUGUAUUAUAu 3'
 		1 - 11
Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
76 mmu-miR-374b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT418787 Map2 microtubule-associated protein 2 1 1
MIRT577252 Zfp84 zinc finger protein 84 1 1
MIRT577346 Zfp11 zinc finger protein 11 1 1
MIRT577582 Tcf21 transcription factor 21 1 1
MIRT577695 Slc35d2 solute carrier family 35, member D2 1 1
MIRT577869 Rassf5 Ras association (RalGDS/AF-6) domain family member 5 1 1
MIRT577940 Ppp6r1 protein phosphatase 6, regulatory subunit 1 1 1
MIRT577949 Pou4f2 POU domain, class 4, transcription factor 2 1 1
MIRT578202 Nadsyn1 NAD synthetase 1 1 1
MIRT578468 Impg2 interphotoreceptor matrix proteoglycan 2 1 1
MIRT578587 Hist1h1d histone cluster 1, H1d 1 1
MIRT579056 Cradd CASP2 and RIPK1 domain containing adaptor with death domain 1 1
MIRT579823 Zfp113 zinc finger protein 113 1 2
MIRT579840 Zer1 zyg-11 related, cell cycle regulator 1 1
MIRT579950 Xpo7 exportin 7 1 1
MIRT579992 Wnt3 wingless-type MMTV integration site family, member 3 1 1
MIRT579997 Wnt11 wingless-type MMTV integration site family, member 11 1 1
MIRT580191 Ttll7 tubulin tyrosine ligase-like family, member 7 1 1
MIRT580256 Trim2 tripartite motif-containing 2 1 1
MIRT580383 Tmem206 transmembrane protein 206 1 2
MIRT580415 Tmem161b transmembrane protein 161B 1 1
MIRT580534 Tead3 TEA domain family member 3 1 1
MIRT580565 Tbx4 T-box 4 1 1
MIRT580611 Syp synaptophysin 1 1
MIRT581171 Sec23ip Sec23 interacting protein 1 1
MIRT581538 Pten phosphatase and tensin homolog 1 1
MIRT581571 Prrx1 paired related homeobox 1 1 1
MIRT581741 Plxnc1 plexin C1 1 1
MIRT581794 Plaur plasminogen activator, urokinase receptor 1 1
MIRT581822 Pkib protein kinase inhibitor beta, cAMP dependent, testis specific 1 1
MIRT581971 Pdcd10 programmed cell death 10 1 1
MIRT582055 Osbp oxysterol binding protein 1 1
MIRT582142 Npr3 natriuretic peptide receptor 3 1 1
MIRT582168 Nkx2-2 NK2 homeobox 2 1 1
MIRT582469 Mex3a mex3 RNA binding family member A 1 1
MIRT582518 March5 membrane-associated ring finger (C3HC4) 5 1 2
MIRT582589 Lrrtm2 leucine rich repeat transmembrane neuronal 2 1 1
MIRT582667 Lmtk2 lemur tyrosine kinase 2 1 1
MIRT583063 Hoxa11 homeobox A11 1 1
MIRT583111 Hexim1 hexamethylene bis-acetamide inducible 1 1 1
MIRT583233 Gpc6 glypican 6 1 1
MIRT583395 Fzd5 frizzled class receptor 5 1 1
MIRT583429 Frmpd4 FERM and PDZ domain containing 4 1 1
MIRT583613 Fam46a family with sequence similarity 46, member A 1 1
MIRT583848 Eea1 early endosome antigen 1 1 1
MIRT584669 B3gat1 beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) 1 1
MIRT584731 Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 1 1
MIRT584872 Ap3m1 adaptor-related protein complex 3, mu 1 subunit 1 1
MIRT585039 Lrrc71 leucine rich repeat containing 71 1 1
MIRT585303 Zfp248 zinc finger protein 248 1 3
MIRT585725 T2 brachyury 2 1 1
MIRT585759 St8sia3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 1 1
MIRT585986 Sfxn4 sideroflexin 4 1 1
MIRT586181 Ptprr protein tyrosine phosphatase, receptor type, R 1 1
MIRT586738 Lcn5 lipocalin 5 1 1
MIRT586778 Jmjd4 jumonji domain containing 4 1 1
MIRT587048 Gm5531 transmembrane epididymal protein 1B 1 1
MIRT587444 Dimt1 DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) 1 1
MIRT588190 A130010J15Rik RIKEN cDNA A130010J15 gene 1 1
MIRT588690 Tet2 tet methylcytosine dioxygenase 2 1 1
MIRT589450 Nck2 non-catalytic region of tyrosine kinase adaptor protein 2 1 1
MIRT590325 Csgalnact2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT590458 Car5b carbonic anhydrase 5b, mitochondrial 1 1
MIRT590752 Actr10 ARP10 actin-related protein 10 1 1
MIRT594398 Ints6 integrator complex subunit 6 1 1
MIRT594639 Mex3c mex3 RNA binding family member C 2 1
MIRT594870 Man1a2 mannosidase, alpha, class 1A, member 2 1 1
MIRT595871 Csmd1 CUB and Sushi multiple domains 1 1 1
MIRT596012 Ceacam1 carcinoembryonic antigen-related cell adhesion molecule 1 1 1
MIRT596332 Rpp14 ribonuclease P 14 subunit 1 1
MIRT600146 Zfp1 zinc finger protein 1 1 1
MIRT601141 Bcl11b B cell leukemia/lymphoma 11B 1 1
MIRT601571 Sumf2 sulfatase modifying factor 2 1 1
MIRT605724 Gmeb1 glucocorticoid modulatory element binding protein 1 1 1
MIRT731705 Myf6 myogenic factor 6 3 1
MIRT735635 Socs1 suppressor of cytokine signaling 1 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-374b Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-374b Glucose NULL 5793 Microarray proximal tubule cell line HK-2 20067797 2010 down-regulated
miR-374b 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-374b 5-Fluorouracil approved 3385 Quantitative real-time PCR MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-374b Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
miR-374b Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-374b-5p Valproic Acid 3121 NSC93819 approved sensitive High Seizure tissue
mmu-miR-374b-5p Levetiracetam 5284583 NSC760119 approved sensitive High Seizure tissue
mmu-miR-374b-5p Sunitinib 5329102 NSC750690 approved resistant High Renal Cell Cancer tissue

Error report submission