miRNA Infomation | |
---|---|
miRNA name | mmu-miR-1186a |
Gene Information | |
---|---|
Gene Symbol | Sycp2 |
Synonyms | 3830402K23Rik, 4930518F03Rik |
Description | synaptonemal complex protein 2 |
Transcript | NM_177191 |
Expression | |
Putative miRNA Targets on Sycp2 | |
3'UTR of Sycp2 (miRNA target sites are highlighted) |
>Sycp2|NM_177191|3'UTR 1 AATCTGGCTGCTGTCAATGAATTTTATGATTAGTTTTTTGTGTATAAATAAAGCACTAATAAAGTAGCTTTGCAAAGATG 81 CATCATCTAAGCACCTCTATTCTTGTGTGCAAGAACCTCCCGACTCAAATGTTAGAGATGAAAAACATGACTCCAAATGC 161 AGCTTGTATGTCCTATGAGCAAACAGTAAAAGGAGCTGACTTTCCTTGGATCATATTTTTATATTAACTATGTCTGTGAA 241 AGTAGTGTCTGTACTAAAGTATTTATATATAAAGTGTAATTTTAAATTAATGCAGTTTTGGAATAAAATATACTGAAATT 321 TGCATGATGGTTTGTAAATATACAAGTATTAAAATATTAGCAATTCTTTGAAAGAGGAAAAGGCTCTGCTTTAAGATCTT 401 TAATTGTTAGTACCTTCATACTTTGAGATATATAGAGTTACAGTGCACTAAAAGTGTTAAAGTGACCTAAAGTTATAGCT 481 ATTTCATAAATATTTTATCACAGTGTAGAAGTCTTAACTACAAAGCAGGCTGCTTGCCATTTCTTTCTAAGCACCTGGTA 561 TTCACCTAATATTTTGTTAGATTGTATTTTAAATAAATGCTTATTTGAGTAAGTATAATTACTTTACAGTTACTATTATT 641 GTGTTTTATGAACCATGACTTACAAGCCACCTTCAGTCAGACACTTGAAGGTAATACCAATCTGAAGGCTGTAGAGTATT 721 TGAGCAATACCAGCATTTAATATTACAGTGGTGAAGTAGTTTCTTAGTCAAGCACAAATACATTCTTGGTGTATTCAATT 801 GACATCAGCTAAGATTTTAAGATTTATGAGGAAAATGATGGGAGTTTCTAGTTTTAAGAAAGAGAGAGATTTTACATTTT 881 ATTAGCCCTTAGATGAACTGTGTGTACAACAAAGAACTGCTAAGATTAATTTTGTAACTCTTGTTTTTTGAGACATGGTC 961 TGTGTAGACCTGGCTAACCTCAAATTCAGTTCTGCCTGCAAACATTAAAGCCATGGGCCCAAACAAATGTCCTTCAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Article |
- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al. - Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
|
114 mmu-miR-1186a Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT579774 | Zfp568 | zinc finger protein 568 | 1 | 1 | ||||||||
MIRT580629 | Sycp2 | synaptonemal complex protein 2 | 1 | 1 | ||||||||
MIRT582212 | Nfatc3 | nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3 | 1 | 1 | ||||||||
MIRT582800 | Kcnmb2 | potassium large conductance calcium-activated channel, subfamily M, beta member 2 | 1 | 1 | ||||||||
MIRT585391 | Wfs1 | wolframin ER transmembrane glycoprotein | 1 | 2 | ||||||||
MIRT589502 | Myo1e | myosin IE | 1 | 2 | ||||||||
MIRT589770 | Itgb3 | integrin beta 3 | 1 | 1 | ||||||||
MIRT593622 | Tstd2 | thiosulfate sulfurtransferase (rhodanese)-like domain containing 2 | 1 | 1 | ||||||||
MIRT593854 | Havcr2 | hepatitis A virus cellular receptor 2 | 1 | 1 | ||||||||
MIRT594849 | Npm3 | nucleoplasmin 3 | 1 | 1 | ||||||||
MIRT596507 | Zfp933 | zinc finger protein 933 | 1 | 1 | ||||||||
MIRT596526 | Zfp882 | zinc finger protein 882 | 1 | 1 | ||||||||
MIRT596548 | Zfp866 | zinc finger protein 866 | 1 | 1 | ||||||||
MIRT596772 | Usp45 | ubiquitin specific petidase 45 | 1 | 1 | ||||||||
MIRT596785 | Ubxn2a | UBX domain protein 2A | 1 | 1 | ||||||||
MIRT596892 | Trp53rk | transformation related protein 53 regulating kinase B | 1 | 1 | ||||||||
MIRT596930 | Tprkb | Tp53rk binding protein | 1 | 1 | ||||||||
MIRT596959 | Tmem88b | transmembrane protein 88B | 1 | 1 | ||||||||
MIRT597152 | Stxbp4 | syntaxin binding protein 4 | 1 | 1 | ||||||||
MIRT597426 | Rp2h | retinitis pigmentosa 2 homolog | 1 | 1 | ||||||||
MIRT597534 | Rapgef4 | Rap guanine nucleotide exchange factor (GEF) 4 | 1 | 1 | ||||||||
MIRT597584 | Ptpn7 | protein tyrosine phosphatase, non-receptor type 7 | 1 | 1 | ||||||||
MIRT597695 | Ppp2r3d | protein phosphatase 2 (formerly 2A), regulatory subunit B'', delta | 1 | 1 | ||||||||
MIRT598007 | Npy1r | neuropeptide Y receptor Y1 | 1 | 1 | ||||||||
MIRT598031 | Nol10 | nucleolar protein 10 | 1 | 1 | ||||||||
MIRT598115 | Ncl | nucleolin | 1 | 1 | ||||||||
MIRT598155 | Mtif2 | mitochondrial translational initiation factor 2 | 1 | 1 | ||||||||
MIRT598268 | Mettl2 | methyltransferase like 2 | 1 | 1 | ||||||||
MIRT598274 | Med16 | mediator complex subunit 16 | 1 | 1 | ||||||||
MIRT598308 | Mc1r | melanocortin 1 receptor | 1 | 1 | ||||||||
MIRT598344 | Mau2 | MAU2 sister chromatid cohesion factor | 1 | 1 | ||||||||
MIRT598391 | Magt1 | magnesium transporter 1 | 1 | 1 | ||||||||
MIRT598427 | Lrrc14b | leucine rich repeat containing 14B | 1 | 1 | ||||||||
MIRT598438 | Lpl | lipoprotein lipase | 1 | 1 | ||||||||
MIRT598663 | Hpgds | hematopoietic prostaglandin D synthase | 1 | 1 | ||||||||
MIRT598704 | Haus2 | HAUS augmin-like complex, subunit 2 | 1 | 1 | ||||||||
MIRT598875 | Glyctk | glycerate kinase | 1 | 1 | ||||||||
MIRT598888 | Glrx2 | glutaredoxin 2 (thioltransferase) | 1 | 1 | ||||||||
MIRT598958 | Gemin8 | gem nuclear organelle associated protein 8 | 1 | 1 | ||||||||
MIRT599163 | Diap2 | diaphanous related formin 2 | 1 | 1 | ||||||||
MIRT599256 | Tmem245 | transmembrane protein 245 | 1 | 1 | ||||||||
MIRT599387 | Clmn | calmin | 1 | 1 | ||||||||
MIRT599416 | Chek2 | checkpoint kinase 2 | 1 | 1 | ||||||||
MIRT599521 | Cbwd1 | COBW domain containing 1 | 1 | 1 | ||||||||
MIRT599544 | Car5b | carbonic anhydrase 5b, mitochondrial | 1 | 1 | ||||||||
MIRT599748 | Anapc16 | anaphase promoting complex subunit 16 | 1 | 1 | ||||||||
MIRT599851 | Adarb1 | adenosine deaminase, RNA-specific, B1 | 1 | 1 | ||||||||
MIRT599902 | Acat1 | acetyl-Coenzyme A acetyltransferase 1 | 1 | 1 | ||||||||
MIRT599921 | A830018L16Rik | RIKEN cDNA A830018L16 gene | 1 | 1 | ||||||||
MIRT599997 | 4930579G24Rik | RIKEN cDNA 4930579G24 gene | 1 | 1 | ||||||||
MIRT600230 | Trim56 | tripartite motif-containing 56 | 1 | 1 | ||||||||
MIRT600272 | Tns4 | tensin 4 | 1 | 1 | ||||||||
MIRT600359 | Srrm4 | serine/arginine repetitive matrix 4 | 1 | 1 | ||||||||
MIRT600536 | Pdzd2 | PDZ domain containing 2 | 1 | 1 | ||||||||
MIRT600568 | Ociad2 | OCIA domain containing 2 | 1 | 1 | ||||||||
MIRT600688 | Lrrc8e | leucine rich repeat containing 8 family, member E | 1 | 1 | ||||||||
MIRT600869 | Gad2 | glutamic acid decarboxylase 2 | 1 | 1 | ||||||||
MIRT600880 | Gabpb2 | GA repeat binding protein, beta 2 | 1 | 1 | ||||||||
MIRT600957 | Elf1 | E74-like factor 1 | 1 | 1 | ||||||||
MIRT601037 | Cntn2 | contactin 2 | 1 | 1 | ||||||||
MIRT601117 | Bri3bp | Bri3 binding protein | 1 | 1 | ||||||||
MIRT601253 | Abl2 | v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) | 1 | 1 | ||||||||
MIRT601372 | Ybey | ybeY metallopeptidase | 1 | 1 | ||||||||
MIRT601482 | Tmod1 | tropomodulin 1 | 1 | 1 | ||||||||
MIRT601550 | Tbc1d24 | TBC1 domain family, member 24 | 1 | 1 | ||||||||
MIRT601675 | Sco1 | SCO1 cytochrome c oxidase assembly protein | 1 | 1 | ||||||||
MIRT601939 | Ogdh | oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) | 1 | 1 | ||||||||
MIRT601945 | Nwd1 | NACHT and WD repeat domain containing 1 | 1 | 1 | ||||||||
MIRT601976 | Nav1 | neuron navigator 1 | 1 | 1 | ||||||||
MIRT602013 | Mpp7 | membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) | 1 | 1 | ||||||||
MIRT602121 | Kremen2 | kringle containing transmembrane protein 2 | 1 | 1 | ||||||||
MIRT602189 | Hyal1 | hyaluronoglucosaminidase 1 | 1 | 1 | ||||||||
MIRT602215 | Hecw1 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 | 1 | 1 | ||||||||
MIRT602246 | Grm1 | glutamate receptor, metabotropic 1 | 1 | 1 | ||||||||
MIRT602369 | Fbxl3 | F-box and leucine-rich repeat protein 3 | 1 | 1 | ||||||||
MIRT602428 | Ercc4 | excision repair cross-complementing rodent repair deficiency, complementation group 4 | 1 | 1 | ||||||||
MIRT602494 | Dkc1 | dyskeratosis congenita 1, dyskerin | 1 | 1 | ||||||||
MIRT602567 | Csf2rb | colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) | 1 | 1 | ||||||||
MIRT602597 | Chrnb4 | cholinergic receptor, nicotinic, beta polypeptide 4 | 1 | 1 | ||||||||
MIRT602687 | Camk4 | calcium/calmodulin-dependent protein kinase IV | 1 | 1 | ||||||||
MIRT602764 | Asxl2 | additional sex combs like 2 (Drosophila) | 1 | 1 | ||||||||
MIRT602851 | Abcd2 | ATP-binding cassette, sub-family D (ALD), member 2 | 1 | 1 | ||||||||
MIRT602908 | 2210016F16Rik | RIKEN cDNA 2210016F16 gene | 1 | 1 | ||||||||
MIRT603036 | Chic1 | cysteine-rich hydrophobic domain 1 | 1 | 1 | ||||||||
MIRT603112 | Xcr1 | chemokine (C motif) receptor 1 | 1 | 1 | ||||||||
MIRT603146 | Ubxn8 | UBX domain protein 8 | 1 | 1 | ||||||||
MIRT603156 | Ubxn4 | UBX domain protein 4 | 1 | 1 | ||||||||
MIRT603435 | Rpl7l1 | ribosomal protein L7-like 1 | 1 | 1 | ||||||||
MIRT603455 | Rhbdl2 | rhomboid, veinlet-like 2 (Drosophila) | 1 | 1 | ||||||||
MIRT603518 | Pxmp4 | peroxisomal membrane protein 4 | 1 | 1 | ||||||||
MIRT603818 | Kif5b | kinesin family member 5B | 1 | 1 | ||||||||
MIRT603872 | Il11 | interleukin 11 | 1 | 1 | ||||||||
MIRT603888 | Il10rb | interleukin 10 receptor, beta | 1 | 1 | ||||||||
MIRT603916 | Hltf | helicase-like transcription factor | 1 | 1 | ||||||||
MIRT603974 | Gnal | guanine nucleotide binding protein, alpha stimulating, olfactory type | 1 | 1 | ||||||||
MIRT604054 | Erich1 | glutamate rich 1 | 1 | 1 | ||||||||
MIRT604186 | Cxcl11 | chemokine (C-X-C motif) ligand 11 | 1 | 1 | ||||||||
MIRT604293 | Ccdc36 | coiled-coil domain containing 36 | 1 | 1 | ||||||||
MIRT604399 | Aida | axin interactor, dorsalization associated | 1 | 1 | ||||||||
MIRT604524 | Ccdc167 | coiled-coil domain containing 167 | 1 | 1 | ||||||||
MIRT604531 | Zmym5 | zinc finger, MYM-type 5 | 1 | 1 | ||||||||
MIRT604577 | Trip4 | thyroid hormone receptor interactor 4 | 1 | 1 | ||||||||
MIRT604627 | Syt11 | synaptotagmin XI | 1 | 1 | ||||||||
MIRT604718 | Samd8 | sterile alpha motif domain containing 8 | 1 | 1 | ||||||||
MIRT604761 | Rab27a | RAB27A, member RAS oncogene family | 1 | 1 | ||||||||
MIRT604851 | Mprip | myosin phosphatase Rho interacting protein | 1 | 1 | ||||||||
MIRT604966 | Gga2 | golgi associated, gamma adaptin ear containing, ARF binding protein 2 | 1 | 1 | ||||||||
MIRT605164 | C030039L03Rik | zinc finger protein 607B | 1 | 1 | ||||||||
MIRT605197 | B4galt6 | UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 | 1 | 1 | ||||||||
MIRT605486 | Slc6a2 | solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 | 1 | 1 | ||||||||
MIRT605618 | Mpv17 | MpV17 mitochondrial inner membrane protein | 1 | 1 | ||||||||
MIRT606168 | Syt13 | synaptotagmin XIII | 1 | 1 | ||||||||
MIRT606224 | Rft1 | RFT1 homolog | 1 | 1 | ||||||||
MIRT606518 | BC026590 | family with sequence similarity 206, member A | 1 | 1 |