miRTarBase - #MIRT580847


—
pre-miRNA Information
pre-miRNA mmu-mir-186   
Genomic Coordinates chr3: 157544279 - 157544349
Synonyms Mirn186, mmu-mir-186, Mir186
Description Mus musculus miR-186 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-186-5p
Sequence 7| CAAAGAAUUCUCCUUUUGGGCU |28
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Sltm   
Synonyms 5730455C01Rik, 5730555F13Rik, 9130215G10Rik, Met
Description SAFB-like, transcription modulator
Transcript NM_025690   
Other Transcripts NM_026337   
Expression
Putative miRNA Targets on Sltm
3'UTR of Sltm
(miRNA target sites are highlighted)		 
>Sltm|NM_025690|3'UTR
   1 CGCAAGCTTCCTGCTGTGGCTTCAAGATAATTTATTGAGATCTCCTGTAAACGTTCCCTGACTGCTTACTAGGAGAACCT
  81 CTGACTGCTTGAGAGTTCTAGCTGACTGTTGTTTTTCTTTATAAAAAAATTTAACACGATTTCTTTTCTCAACTTTAGAG
 161 AAGATGTTTAAATAGTTCTGTTGAAACTTTTCATAGTTTTGTGTACCATTCAACCTTTTCTTGCAGCACTGAGACCCATT
 241 TGAAAGGATTGGCACAAGGCTGTTCTGTTTGGCACTGTGTGAACATGAGTGGTTTGCAGCTGAATGGTAGTGGTTTCATT
 321 TGCAGCGTAGCTCTGTGGTGTCACCAGTGTTGGCTGCCTCCATTTTGAAGGCTATTTGAGCTTCAAAAGCCTGCTGTCTA
 401 ATTTTTAGAGAATAAGATTGTTCCCTGCATTTCGGAGTATTATGTAACCTATTTTTGCAGAAGGTACTGTTACATTAAGT
 481 GCATCTGTGTATCCTGGTTAAAAAAAAAATGTAATCTTTTTGGAAATAAACCTTCATATTCTGTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucGGGUUUUC---C-UC---UUAAGAAac 5'
            ::||||||   |  |   ||||:||  
Target 5' gcTTCAAAAGCCTGCTGTCTAATTTTTag 3'
 380 - 408 116.00 -5.56
2 
miRNA  3' ucggGUUUUCCUCUUAAGAAAc 5'
              || ||||   :|||| | 
Target 5' ttggCACAAGG-CTGTTCTGTt 3'
 249 - 269 105.00 -6.80
3 
miRNA  3' ucggguuuuccucuuAAGAAac 5'
                         |||||  
Target 5' gtaccattcaaccttTTCTTgc 3'
 203 - 224 100.00 -5.17
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
46 mmu-miR-186-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT577608 Stxbp4 syntaxin binding protein 4 1 1
MIRT577884 Qpct glutaminyl-peptide cyclotransferase (glutaminyl cyclase) 1 1
MIRT578137 Noc3l NOC3 like DNA replication regulator 1 1
MIRT578249 Mnat1 menage a trois 1 1 1
MIRT579147 Ces2g carboxylesterase 2G 1 1
MIRT579219 Ccdc138 coiled-coil domain containing 138 1 1
MIRT579578 4933427D06Rik RIKEN cDNA 4933427D06 gene 1 1
MIRT580348 Tmem33 transmembrane protein 33 1 1
MIRT580592 Tbl1xr1 transducin (beta)-like 1X-linked receptor 1 1 1
MIRT580668 Stk32a serine/threonine kinase 32A 1 1
MIRT580744 Srek1 splicing regulatory glutamine/lysine-rich protein 1 1 1
MIRT580779 Sp6 trans-acting transcription factor 6 1 1
MIRT580847 Sltm SAFB-like, transcription modulator 1 1
MIRT580944 Slc26a5 solute carrier family 26, member 5 1 1
MIRT581214 Samd4 sterile alpha motif domain containing 4 1 1
MIRT581276 Rprd2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT581520 Ptprb protein tyrosine phosphatase, receptor type, B 1 1
MIRT582203 Nfia nuclear factor I/A 1 1
MIRT582893 Ildr2 immunoglobulin-like domain containing receptor 2 1 1
MIRT582996 Id4 inhibitor of DNA binding 4 1 1
MIRT583079 Hnrnpa3 heterogeneous nuclear ribonucleoprotein A3 1 1
MIRT583125 Heca hdc homolog, cell cycle regulator 1 1
MIRT583739 Epm2aip1 EPM2A (laforin) interacting protein 1 1 1
MIRT584127 Crispld2 cysteine-rich secretory protein LCCL domain containing 2 1 1
MIRT584166 Cpox coproporphyrinogen oxidase 1 1
MIRT584531 C230081A13Rik pseudopodium-enriched atypical kinase 1 1 1
MIRT584646 Bach2 BTB and CNC homology, basic leucine zipper transcription factor 2 1 1
MIRT587978 Armc1 armadillo repeat containing 1 1 1
MIRT588832 Sp1 trans-acting transcription factor 1 1 2
MIRT590758 Acbd5 acyl-Coenzyme A binding domain containing 5 1 1
MIRT593146 Mmp12 matrix metallopeptidase 12 1 4
MIRT593495 Gjc3 gap junction protein, gamma 3 1 1
MIRT594880 Lrig2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT594898 Ifi204 interferon activated gene 204 1 1
MIRT594932 Gdi2 guanosine diphosphate (GDP) dissociation inhibitor 2 1 1
MIRT594945 Fmnl2 formin-like 2 1 1
MIRT595197 Emc3 ER membrane protein complex subunit 3 1 1
MIRT595343 Frmd4a FERM domain containing 4A 1 1
MIRT595402 Arsk arylsulfatase K 1 1
MIRT595430 A630033H20Rik RIKEN cDNA A630033H20 gene 1 1
MIRT595947 Nelfa negative elongation factor complex member A, Whsc2 1 1
MIRT596153 Opn5 opsin 5 1 1
MIRT601390 Utp23 UTP23 small subunit processome component 1 1
MIRT602153 Intu inturned planar cell polarity protein 1 1
MIRT602577 Colec12 collectin sub-family member 12 1 1
MIRT604817 Nr5a2 nuclear receptor subfamily 5, group A, member 2 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-186 Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 down-regulated
miR-186 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-186 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-186 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miR-186 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated

Error report submission