pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-374b |
Genomic Coordinates | chrX: 103573060 - 103573154 |
Description | Mus musculus miR-374b stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-374b-5p |
Sequence | 22| AUAUAAUACAACCUGCUAAGUG |43 |
Evidence | Experimental |
Experiments | Cloned |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Sec23ip | ||||||||||||||||||||
Synonyms | D7Ertd373e, p125 | ||||||||||||||||||||
Description | Sec23 interacting protein | ||||||||||||||||||||
Transcript | NM_001029982 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Sec23ip | |||||||||||||||||||||
3'UTR of Sec23ip (miRNA target sites are highlighted) |
>Sec23ip|NM_001029982|3'UTR 1 GCAGACTTGCATTTTACAGGGAAGTTCCAGCATGAGTGTCATTGCTGAGAGGCTCCTTGGTGGCTGATCCGTCTTTGCAT 81 CTATGATGGATGACAGAAAAGTGACTCAGCAACAATTGCTAGCGTGGACTTCTCAGATGTAGGAATTTGTTTTTAAAACA 161 GAACAGAAAGATGCTGAAAAAAAAAATCAGTACTGTATTTGAACAGTGTAGAAGAAAAACTACAACCGTAAAATGATGCT 241 GTGGGAAATTCTCAGATCTTTATAGTTATATAGTTATCTAAGTTGTGTCCTAATGAAGAGATATTTGTAGCATGCAAATG 321 GTTATTTCTATTTCTTAAAACTATTGTCAATGGGCTATTAAACTTATATTTTTCTTTGTATTAATGCAATATGTTATTTT 401 TATTTAAATCTGGGCTTCTTGTGAAACTATAGTAACATGATTTTTAAGAAATTTAGGCTAGGCATGGTATCACAGGCCTT 481 TAATCTCAGCACTCAAGAAGCAAAGGCAGGTGGATCTCTGAGCTGGAGGTCAGCTTGGTCCATATAGCAAGTTTCAGGAC 561 AGTCAGGACTACATAGGAGACTATCTCAGAAACAAAAAAAAAAGAAACTTGTGCTGTCCTTTAAATGTGAATTGATCGGA 641 GCTGGAGCTGCCCTGGTGTGGAGTTGCTCCTGCTTGTGACAAGGCCTCCTCATCCCAGGCTGATGTCAGCTTTTATGAAG 721 CCGAATGCCATCGCCGAGAGCCTAGTTGCAGAAGTGAAGCACTTTTTTTTTTTTTTTTTTTTTTTTAAAGATTTATTTAT 801 TTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGTCTCAGGTCTCATTACAGATGGTTGTGAGC 881 CACCATGTGGTTGCTGGGATTTGAACTCTGGACCTTCGTAAGAACAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCA 961 GCCCGTGAAGCACTTTTTACTTTCTAGAACTCTTGTGATGATCTGACCTCTCCTGGCACATGCATATCCCCTGCGAGTTG 1041 AGCAAATAACAGGCTTTCACAGTGAGTGGAGCTTTCTGTGCCAGCACTCAGTGCCTGAGGTGCGATACTGAGAGAAGCAG 1121 AGTGGAAGGCCTGTTGCGTTGGTTCAGCCTTACTTGCAGCGGTGTGCTTGAGAGGATGCAGAGCTGCCTGAAGACTGCTC 1201 TGCAGCACCCTTTGTTAACTATAAACTCAGTCTCTAAATAGTTCCTAACAGACATTGGGGATGCTGATTTCCTTCTTTTG 1281 TTACATAGCAGGAACATTTTATGTCATTTACATAGTTCTCATGGAACATGGAATTTTTTTGAAAGCAACATATAATACAC 1361 ATTTTTGTGTATGTGTTTTACCTGGTGTGAATAAAACAATAACATTGATTCTCTTTTTAAAGCTGCAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | C2C12 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes
... - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell. |
Article |
- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al. - Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
|
76 mmu-miR-374b-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT418787 | Map2 | microtubule-associated protein 2 | ![]() |
1 | 1 | |||||||
MIRT577252 | Zfp84 | zinc finger protein 84 | ![]() |
1 | 1 | |||||||
MIRT577346 | Zfp11 | zinc finger protein 11 | ![]() |
1 | 1 | |||||||
MIRT577582 | Tcf21 | transcription factor 21 | ![]() |
1 | 1 | |||||||
MIRT577695 | Slc35d2 | solute carrier family 35, member D2 | ![]() |
1 | 1 | |||||||
MIRT577869 | Rassf5 | Ras association (RalGDS/AF-6) domain family member 5 | ![]() |
1 | 1 | |||||||
MIRT577940 | Ppp6r1 | protein phosphatase 6, regulatory subunit 1 | ![]() |
1 | 1 | |||||||
MIRT577949 | Pou4f2 | POU domain, class 4, transcription factor 2 | ![]() |
1 | 1 | |||||||
MIRT578202 | Nadsyn1 | NAD synthetase 1 | ![]() |
1 | 1 | |||||||
MIRT578468 | Impg2 | interphotoreceptor matrix proteoglycan 2 | ![]() |
1 | 1 | |||||||
MIRT578587 | Hist1h1d | histone cluster 1, H1d | ![]() |
1 | 1 | |||||||
MIRT579056 | Cradd | CASP2 and RIPK1 domain containing adaptor with death domain | ![]() |
1 | 1 | |||||||
MIRT579823 | Zfp113 | zinc finger protein 113 | ![]() |
1 | 2 | |||||||
MIRT579840 | Zer1 | zyg-11 related, cell cycle regulator | ![]() |
1 | 1 | |||||||
MIRT579950 | Xpo7 | exportin 7 | ![]() |
1 | 1 | |||||||
MIRT579992 | Wnt3 | wingless-type MMTV integration site family, member 3 | ![]() |
1 | 1 | |||||||
MIRT579997 | Wnt11 | wingless-type MMTV integration site family, member 11 | ![]() |
1 | 1 | |||||||
MIRT580191 | Ttll7 | tubulin tyrosine ligase-like family, member 7 | ![]() |
1 | 1 | |||||||
MIRT580256 | Trim2 | tripartite motif-containing 2 | ![]() |
1 | 1 | |||||||
MIRT580383 | Tmem206 | transmembrane protein 206 | ![]() |
1 | 2 | |||||||
MIRT580415 | Tmem161b | transmembrane protein 161B | ![]() |
1 | 1 | |||||||
MIRT580534 | Tead3 | TEA domain family member 3 | ![]() |
1 | 1 | |||||||
MIRT580565 | Tbx4 | T-box 4 | ![]() |
1 | 1 | |||||||
MIRT580611 | Syp | synaptophysin | ![]() |
1 | 1 | |||||||
MIRT581171 | Sec23ip | Sec23 interacting protein | ![]() |
1 | 1 | |||||||
MIRT581538 | Pten | phosphatase and tensin homolog | ![]() |
1 | 1 | |||||||
MIRT581571 | Prrx1 | paired related homeobox 1 | ![]() |
1 | 1 | |||||||
MIRT581741 | Plxnc1 | plexin C1 | ![]() |
1 | 1 | |||||||
MIRT581794 | Plaur | plasminogen activator, urokinase receptor | ![]() |
1 | 1 | |||||||
MIRT581822 | Pkib | protein kinase inhibitor beta, cAMP dependent, testis specific | ![]() |
1 | 1 | |||||||
MIRT581971 | Pdcd10 | programmed cell death 10 | ![]() |
1 | 1 | |||||||
MIRT582055 | Osbp | oxysterol binding protein | ![]() |
1 | 1 | |||||||
MIRT582142 | Npr3 | natriuretic peptide receptor 3 | ![]() |
1 | 1 | |||||||
MIRT582168 | Nkx2-2 | NK2 homeobox 2 | ![]() |
1 | 1 | |||||||
MIRT582469 | Mex3a | mex3 RNA binding family member A | ![]() |
1 | 1 | |||||||
MIRT582518 | March5 | membrane-associated ring finger (C3HC4) 5 | ![]() |
1 | 2 | |||||||
MIRT582589 | Lrrtm2 | leucine rich repeat transmembrane neuronal 2 | ![]() |
1 | 1 | |||||||
MIRT582667 | Lmtk2 | lemur tyrosine kinase 2 | ![]() |
1 | 1 | |||||||
MIRT583063 | Hoxa11 | homeobox A11 | ![]() |
1 | 1 | |||||||
MIRT583111 | Hexim1 | hexamethylene bis-acetamide inducible 1 | ![]() |
1 | 1 | |||||||
MIRT583233 | Gpc6 | glypican 6 | ![]() |
1 | 1 | |||||||
MIRT583395 | Fzd5 | frizzled class receptor 5 | ![]() |
1 | 1 | |||||||
MIRT583429 | Frmpd4 | FERM and PDZ domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT583613 | Fam46a | family with sequence similarity 46, member A | ![]() |
1 | 1 | |||||||
MIRT583848 | Eea1 | early endosome antigen 1 | ![]() |
1 | 1 | |||||||
MIRT584669 | B3gat1 | beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) | ![]() |
1 | 1 | |||||||
MIRT584731 | Atp2b2 | ATPase, Ca++ transporting, plasma membrane 2 | ![]() |
1 | 1 | |||||||
MIRT584872 | Ap3m1 | adaptor-related protein complex 3, mu 1 subunit | ![]() |
1 | 1 | |||||||
MIRT585039 | Lrrc71 | leucine rich repeat containing 71 | ![]() |
1 | 1 | |||||||
MIRT585303 | Zfp248 | zinc finger protein 248 | ![]() |
1 | 3 | |||||||
MIRT585725 | T2 | brachyury 2 | ![]() |
1 | 1 | |||||||
MIRT585759 | St8sia3 | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 | ![]() |
1 | 1 | |||||||
MIRT585986 | Sfxn4 | sideroflexin 4 | ![]() |
1 | 1 | |||||||
MIRT586181 | Ptprr | protein tyrosine phosphatase, receptor type, R | ![]() |
1 | 1 | |||||||
MIRT586738 | Lcn5 | lipocalin 5 | ![]() |
1 | 1 | |||||||
MIRT586778 | Jmjd4 | jumonji domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT587048 | Gm5531 | transmembrane epididymal protein 1B | ![]() |
1 | 1 | |||||||
MIRT587444 | Dimt1 | DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) | ![]() |
1 | 1 | |||||||
MIRT588190 | A130010J15Rik | RIKEN cDNA A130010J15 gene | ![]() |
1 | 1 | |||||||
MIRT588690 | Tet2 | tet methylcytosine dioxygenase 2 | ![]() |
1 | 1 | |||||||
MIRT589450 | Nck2 | non-catalytic region of tyrosine kinase adaptor protein 2 | ![]() |
1 | 1 | |||||||
MIRT590325 | Csgalnact2 | chondroitin sulfate N-acetylgalactosaminyltransferase 2 | ![]() |
1 | 1 | |||||||
MIRT590458 | Car5b | carbonic anhydrase 5b, mitochondrial | ![]() |
1 | 1 | |||||||
MIRT590752 | Actr10 | ARP10 actin-related protein 10 | ![]() |
1 | 1 | |||||||
MIRT594398 | Ints6 | integrator complex subunit 6 | ![]() |
1 | 1 | |||||||
MIRT594639 | Mex3c | mex3 RNA binding family member C | ![]() |
![]() |
2 | 1 | ||||||
MIRT594870 | Man1a2 | mannosidase, alpha, class 1A, member 2 | ![]() |
1 | 1 | |||||||
MIRT595871 | Csmd1 | CUB and Sushi multiple domains 1 | ![]() |
1 | 1 | |||||||
MIRT596012 | Ceacam1 | carcinoembryonic antigen-related cell adhesion molecule 1 | ![]() |
1 | 1 | |||||||
MIRT596332 | Rpp14 | ribonuclease P 14 subunit | ![]() |
1 | 1 | |||||||
MIRT600146 | Zfp1 | zinc finger protein 1 | ![]() |
1 | 1 | |||||||
MIRT601141 | Bcl11b | B cell leukemia/lymphoma 11B | ![]() |
1 | 1 | |||||||
MIRT601571 | Sumf2 | sulfatase modifying factor 2 | ![]() |
1 | 1 | |||||||
MIRT605724 | Gmeb1 | glucocorticoid modulatory element binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT731705 | Myf6 | myogenic factor 6 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT735635 | Socs1 | suppressor of cytokine signaling 1 | ![]() |
![]() |
![]() |
3 | 0 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|