pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-466e |
Genomic Coordinates | chr2: 10479088 - 10479171 |
Synonyms | mmu-mir-466e, Mir466e |
Description | Mus musculus miR-466e stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-466e-3p |
Sequence | 51| UAUACAUACACGCACACAUAAGA |73 |
Evidence | Experimental |
Experiments | Cloned |
Putative Targets |
Gene Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Il3 | |||||||||||||||
Synonyms | BPA, Csfmu, HCGF, Il-3, MCGF, PSF | |||||||||||||||
Description | interleukin 3 | |||||||||||||||
Transcript | NM_010556 | |||||||||||||||
Expression | ||||||||||||||||
Putative miRNA Targets on Il3 | ||||||||||||||||
3'UTR of Il3 (miRNA target sites are highlighted) |
>Il3|NM_010556|3'UTR 1 AACAGCAGGCAGAGCACCTAAAGTCTGAATGTTCCTCATGGCCCATGGTCAAAAGGATTTTACATTCCTTTATGCCATCA 81 AATGTCTTATCAATTTATCTACTTTCTGAAATTTACAACTCTCCTTTGGCTTTACCTAATTATGTTCCTATTTTATTCCA 161 TTAAGGCTATTTATTTATGTATTTATGTATTTATTTATTTATTGCCTTCTGTGATGTGAGTATATCTGTTTTAGCTGAGG 241 AGGAGTTTCTCCAAAGAAAATTCCAAGGAAGACTGGGGCCATGTTCATTTGTCCCTTGTGGAAATAAATAACTTTGAAC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
|||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | C2C12 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes
... - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al. - Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
|
CLIP-seq Support 1 for dataset GSM1385343 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | C2C12 / C2C12_DM_Ago2_CLIP-Seq_myotubes |
Location of target site | NM_010556 | 3UTR | AUUUAUGUAUUUAUGUAUUUAUUUAUUUAUUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 25083871 / GSE57596 |
CLIP-seq Viewer | Link |
186 mmu-miR-466e-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT577218 | Zfp963 | zinc finger protein 963 | ![]() |
![]() |
2 | 6 | ||||||
MIRT577289 | Zfp446 | zinc finger protein 446 | ![]() |
![]() |
2 | 2 | ||||||
MIRT577554 | Tdrd1 | tudor domain containing 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT577573 | Tctn3 | tectonic family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT577705 | Slc28a3 | solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT577720 | Slc22a15 | solute carrier family 22 (organic anion/cation transporter), member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT577765 | Serpinb10 | serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10 | ![]() |
1 | 1 | |||||||
MIRT577864 | Rassf5 | Ras association (RalGDS/AF-6) domain family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT577925 | Prl5a1 | prolactin family 5, subfamily a, member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT577975 | Pira2 | paired-Ig-like receptor A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT577982 | Pira1 | paired-Ig-like receptor A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT578457 | Ints12 | integrator complex subunit 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT578576 | Hist1h1d | histone cluster 1, H1d | ![]() |
![]() |
2 | 2 | ||||||
MIRT578612 | Haus2 | HAUS augmin-like complex, subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT578669 | Gramd1c | GRAM domain containing 1C | ![]() |
![]() |
2 | 2 | ||||||
MIRT578694 | Golt1a | golgi transport 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT578832 | Fech | ferrochelatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT578857 | Mtfr2 | mitochondrial fission regulator 2 | ![]() |
1 | 3 | |||||||
MIRT578898 | Erich1 | glutamate rich 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT579230 | Ccdc138 | coiled-coil domain containing 138 | ![]() |
![]() |
2 | 2 | ||||||
MIRT579236 | Casp8 | caspase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT579263 | Bub1 | BUB1, mitotic checkpoint serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT579331 | Atf7 | activating transcription factor 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT579464 | Acot11 | acyl-CoA thioesterase 11 | ![]() |
![]() |
2 | 4 | ||||||
MIRT579502 | A630001G21Rik | RIKEN cDNA A630001G21 gene | ![]() |
![]() |
2 | 2 | ||||||
MIRT579550 | Tmem241 | transmembrane protein 241 | ![]() |
1 | 1 | |||||||
MIRT579628 | Mettl20 | electron transfer flavoprotein beta subunit lysine methyltransferase | ![]() |
1 | 1 | |||||||
MIRT579756 | Zfp608 | zinc finger protein 608 | ![]() |
![]() |
2 | 2 | ||||||
MIRT579920 | Zbtb39 | zinc finger and BTB domain containing 39 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580179 | Twist2 | twist basic helix-loop-helix transcription factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580204 | Ttc7 | tetratricopeptide repeat domain 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580221 | Tspan12 | tetraspanin 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580287 | Trhr | thyrotropin releasing hormone receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT580313 | Tnrc6b | trinucleotide repeat containing 6b | ![]() |
![]() |
2 | 2 | ||||||
MIRT580389 | Slc35g1 | solute carrier family 35, member G1 | ![]() |
1 | 1 | |||||||
MIRT580402 | Tmem167 | transmembrane protein 167 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580422 | Tmem161b | transmembrane protein 161B | ![]() |
![]() |
2 | 2 | ||||||
MIRT580482 | Tigd5 | tigger transposable element derived 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580511 | Tet3 | tet methylcytosine dioxygenase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580643 | Stxbp6 | syntaxin binding protein 6 (amisyn) | ![]() |
![]() |
2 | 4 | ||||||
MIRT580700 | Stard8 | START domain containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580754 | Spry1 | sprouty homolog 1 (Drosophila) | ![]() |
![]() |
2 | 2 | ||||||
MIRT580818 | Snx27 | sorting nexin family member 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580863 | Slc8a1 | solute carrier family 8 (sodium/calcium exchanger), member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT580877 | Slc7a11 | solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581027 | Sipa1l1 | signal-induced proliferation-associated 1 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581107 | Sept8 | septin 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581119 | Sept3 | septin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581208 | Satb2 | special AT-rich sequence binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581412 | Rbm47 | RNA binding motif protein 47 | ![]() |
![]() |
2 | 4 | ||||||
MIRT581498 | Pvrl4 | nectin cell adhesion molecule 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581511 | Ptpro | protein tyrosine phosphatase, receptor type, O | ![]() |
![]() |
2 | 2 | ||||||
MIRT581550 | Ptdss1 | phosphatidylserine synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581612 | Prkcd | protein kinase C, delta | ![]() |
![]() |
2 | 2 | ||||||
MIRT581621 | Prkca | protein kinase C, alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT581701 | Ppm1k | protein phosphatase 1K (PP2C domain containing) | ![]() |
![]() |
2 | 2 | ||||||
MIRT581727 | Pofut1 | protein O-fucosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581758 | Plxna1 | plexin A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581814 | Plag1 | pleiomorphic adenoma gene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581840 | Piwil2 | piwi-like RNA-mediated gene silencing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581872 | Pik3ca | phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT581889 | Pias1 | protein inhibitor of activated STAT 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581924 | Pgm2l1 | phosphoglucomutase 2-like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT581979 | Pcsk5 | proprotein convertase subtilisin/kexin type 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT582089 | Ogdh | oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) | ![]() |
![]() |
2 | 2 | ||||||
MIRT582162 | Nln | neurolysin (metallopeptidase M3 family) | ![]() |
![]() |
2 | 2 | ||||||
MIRT582194 | Nfkbia | nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT582310 | Nacc2 | nucleus accumbens associated 2, BEN and BTB (POZ) domain containing | ![]() |
![]() |
2 | 8 | ||||||
MIRT582534 | Mapk1 | mitogen-activated protein kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT582686 | Lhfpl4 | lipoma HMGIC fusion partner-like protein 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT582901 | Il3 | interleukin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT582926 | Il15ra | interleukin 15 receptor, alpha chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT582947 | Ikzf5 | IKAROS family zinc finger 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT583009 | Iars2 | isoleucine-tRNA synthetase 2, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT583029 | Htt | huntingtin | ![]() |
![]() |
2 | 2 | ||||||
MIRT583120 | Hecw1 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT583215 | Gpr123 | adhesion G protein-coupled receptor A1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT583298 | Glra2 | glycine receptor, alpha 2 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT583335 | Paxbp1 | PAX3 and PAX7 binding protein 1 | ![]() |
1 | 3 | |||||||
MIRT583370 | Gabra2 | gamma-aminobutyric acid (GABA) A receptor, subunit alpha 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT583404 | Fzd3 | frizzled class receptor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT583537 | Fbxo45 | F-box protein 45 | ![]() |
![]() |
2 | 2 | ||||||
MIRT583598 | Fam63b | MINDY lysine 48 deubiquitinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT583638 | Tmem236 | transmembrane protein 236 | ![]() |
1 | 1 | |||||||
MIRT583975 | Dennd4a | DENN/MADD domain containing 4A | ![]() |
![]() |
2 | 2 | ||||||
MIRT584001 | Dcdc2a | doublecortin domain containing 2a | ![]() |
![]() |
2 | 2 | ||||||
MIRT584050 | Cysltr1 | cysteinyl leukotriene receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT584093 | Csrnp3 | cysteine-serine-rich nuclear protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT584300 | Chic1 | cysteine-rich hydrophobic domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT584316 | Chek1 | checkpoint kinase 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT584366 | Cdk19 | cyclin-dependent kinase 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT584724 | Atp8b1 | ATPase, class I, type 8B, member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT584781 | Arl8a | ADP-ribosylation factor-like 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT584804 | Arl15 | ADP-ribosylation factor-like 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT584827 | Arhgef33 | Rho guanine nucleotide exchange factor (GEF) 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT584906 | Alg6 | asparagine-linked glycosylation 6 (alpha-1,3,-glucosyltransferase) | ![]() |
![]() |
2 | 2 | ||||||
MIRT584953 | Adamts4 | a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT585037 | Lrrc71 | leucine rich repeat containing 71 | ![]() |
1 | 1 | |||||||
MIRT585057 | Pcnxl4 | pecanex homolog 4 | ![]() |
1 | 1 | |||||||
MIRT585104 | Zfp941 | zinc finger protein 941 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585152 | Zfp874b | zinc finger protein 874b | ![]() |
![]() |
2 | 2 | ||||||
MIRT585337 | Ybey | ybeY metallopeptidase | ![]() |
![]() |
2 | 2 | ||||||
MIRT585398 | Wfdc12 | WAP four-disulfide core domain 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585482 | Txlnb | taxilin beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT585516 | Trp53rk | transformation related protein 53 regulating kinase B | ![]() |
![]() |
2 | 2 | ||||||
MIRT585552 | Tpte | transmembrane phosphatase with tensin homology | ![]() |
![]() |
2 | 2 | ||||||
MIRT585706 | Tbc1d24 | TBC1 domain family, member 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585749 | Stat1 | signal transducer and activator of transcription 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585894 | Slc1a7 | solute carrier family 1 (glutamate transporter), member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT585919 | Slc16a9 | solute carrier family 16 (monocarboxylic acid transporters), member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT586027 | Sass6 | SAS-6 centriolar assembly protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT586036 | Rsad1 | radical S-adenosyl methionine domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT586137 | Rbm41 | RNA binding motif protein 41 | ![]() |
![]() |
2 | 2 | ||||||
MIRT586185 | Ptprr | protein tyrosine phosphatase, receptor type, R | ![]() |
![]() |
2 | 2 | ||||||
MIRT586347 | Pdxk | pyridoxal (pyridoxine, vitamin B6) kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT586392 | Padi2 | peptidyl arginine deiminase, type II | ![]() |
![]() |
2 | 4 | ||||||
MIRT586426 | Oip5 | Opa interacting protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT586504 | Neu4 | sialidase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT586627 | Mfsd2b | major facilitator superfamily domain containing 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT586676 | Mbd4 | methyl-CpG binding domain protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT586952 | Gstt3 | glutathione S-transferase, theta 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587235 | Nxpe3 | neurexophilin and PC-esterase domain family, member 3 | ![]() |
1 | 1 | |||||||
MIRT587548 | Cxcl5 | chemokine (C-X-C motif) ligand 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587740 | Cd28 | CD28 antigen | ![]() |
![]() |
2 | 2 | ||||||
MIRT587785 | Ccpg1 | cell cycle progression 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT587902 | BC003965 | cDNA sequence BC003965 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588023 | Akap7 | A kinase (PRKA) anchor protein 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588064 | Fam211b | leucine rich repeat containing 75B | ![]() |
1 | 1 | |||||||
MIRT588077 | AI429214 | expressed sequence AI429214 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588154 | Ccdc169 | coiled-coil domain containing 169 | ![]() |
1 | 1 | |||||||
MIRT588370 | Zfp462 | zinc finger protein 462 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588437 | Ythdc2 | YTH domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588493 | Wbp4 | WW domain binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588518 | Uty | ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome | ![]() |
![]() |
2 | 2 | ||||||
MIRT588605 | Tsc22d3 | TSC22 domain family, member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588652 | Tmem200a | transmembrane protein 200A | ![]() |
![]() |
2 | 2 | ||||||
MIRT588747 | Synj2bp | synaptojanin 2 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT588778 | Strbp | spermatid perinuclear RNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT588794 | Ss18l1 | SS18, nBAF chromatin remodeling complex subunit like 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT588817 | Srgap3 | SLIT-ROBO Rho GTPase activating protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588838 | Sort1 | sortilin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT588962 | Scn2a1 | sodium channel, voltage-gated, type II, alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT589067 | Rbbp9 | retinoblastoma binding protein 9, serine hydrolase | ![]() |
![]() |
2 | 2 | ||||||
MIRT589077 | Rbbp5 | retinoblastoma binding protein 5, histone lysine methyltransferase complex subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT589087 | Rasal2 | RAS protein activator like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589114 | Rasa2 | RAS p21 protein activator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589121 | Rai1 | retinoic acid induced 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589139 | Rad51d | RAD51 paralog D | ![]() |
1 | 1 | |||||||
MIRT589277 | Pitpnb | phosphatidylinositol transfer protein, beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT589409 | Nrf1 | nuclear respiratory factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589459 | Nceh1 | neutral cholesterol ester hydrolase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589513 | Mtf1 | metal response element binding transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589634 | Loxl3 | lysyl oxidase-like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589758 | Iws1 | IWS1, SUPT6 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT589896 | Gtpbp2 | GTP binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT589946 | Gfod1 | glucose-fructose oxidoreductase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590058 | Fbxl17 | F-box and leucine-rich repeat protein 17 | ![]() |
![]() |
2 | 4 | ||||||
MIRT590129 | Ephb3 | Eph receptor B3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590405 | Ccna2 | cyclin A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590436 | Casz1 | castor zinc finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590466 | Car5b | carbonic anhydrase 5b, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT590476 | Camsap2 | calmodulin regulated spectrin-associated protein family, member 2 | ![]() |
1 | 1 | |||||||
MIRT590512 | Bsn | bassoon | ![]() |
![]() |
2 | 6 | ||||||
MIRT590570 | B3gnt2 | UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT590731 | Ado | 2-aminoethanethiol (cysteamine) dioxygenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT590816 | 1110059G10Rik | RIKEN cDNA 1110059G10 gene | ![]() |
![]() |
2 | 2 | ||||||
MIRT591122 | Oas3 | 2'-5' oligoadenylate synthetase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT591368 | E2f1 | E2F transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592056 | Tbc1d13 | TBC1 domain family, member 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592232 | Ly96 | lymphocyte antigen 96 | ![]() |
![]() |
2 | 2 | ||||||
MIRT592722 | Fbxl14 | F-box and leucine-rich repeat protein 14 | ![]() |
![]() |
2 | 6 | ||||||
MIRT592778 | Diap2 | diaphanous related formin 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT593254 | Tas1r3 | taste receptor, type 1, member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT594456 | Evi2b | ecotropic viral integration site 2b | ![]() |
![]() |
2 | 2 | ||||||
MIRT594616 | Myt1l | myelin transcription factor 1-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT594672 | Ehf | ets homologous factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT594751 | Wdr89 | WD repeat domain 89 | ![]() |
![]() |
2 | 2 | ||||||
MIRT595407 | Arid2 | AT rich interactive domain 2 (ARID, RFX-like) | ![]() |
![]() |
2 | 2 | ||||||
MIRT595645 | Abi3bp | ABI gene family, member 3 (NESH) binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT603345 | Slc16a10 | solute carrier family 16 (monocarboxylic acid transporters), member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT604327 | Bpifc | BPI fold containing family C | ![]() |
![]() |
2 | 2 | ||||||
MIRT604500 | 2510049J12Rik | makorin, ring finger protein 2, opposite strand | ![]() |
![]() |
2 | 2 | ||||||
MIRT604864 | Mef2a | myocyte enhancer factor 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT605407 | Tacr2 | tachykinin receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT605870 | Atpbd4 | diphthamine biosynthesis 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT606108 | Unc5c | unc-5 netrin receptor C | ![]() |
![]() |
2 | 2 |