| pre-miRNA Information | |
|---|---|
| pre-miRNA | mmu-mir-129-1 |
| Genomic Coordinates | chr6: 29022619 - 29022691 |
| Description | Mus musculus miR-129-1 stem-loop |
| Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
| RNA Secondary Structure |  |
| Mature miRNA Information | |
|---|---|
| Mature miRNA | mmu-miR-129-1-3p |
| Sequence | 49| AAGCCCUUACCCCAAAAAGUAU |70 |
| Evidence | Experimental |
| Experiments | Illumina |
| Putative Targets | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | Il11 | ||||||||||||||||||||
| Synonyms | IL-11 | ||||||||||||||||||||
| Description | interleukin 11 | ||||||||||||||||||||
| Transcript | NM_008350 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on Il11 | |||||||||||||||||||||
| 3'UTR of Il11 (miRNA target sites are highlighted) |
>Il11|NM_008350|3'UTR 1 CTCGGGACTGAAAACCACCATCGATACCGCCCTTTAAAACCAGATCTTATTTATTTATTTATTTTGGTACTTGGAGGGGG 81 GCATGATGATCAGGGGCATGCCACACCCCAAACAACCGCCCCACACCCAGCTAGACAGTCTTTCCAGTAGACCTGGGTGA 161 GGGGGATCACCTGTGGCTTATTTATACTTATTTATTTAAACAATTGGGGGGTGGGTGGGTGCATCTGAGACCCTGAAGAG 241 CAGGGAACTGAGATCCTGGGTTCTGGGGTCTCTATGAAATCTGTTCACAGTGTCTTCCTCACTTCCTACATTATTTATTA 321 AACGATTACTTTTTATATTAAGAGGAGGAAGGAGGGAAGCCGGGCGTGGTGGCGCATGCCTTTAATCCCAGCACTCGGGA 401 GGCAGAGGCAGGCAGATTTCTGAGTTCGAGGCCAGCCTGGTCTAAGAGTGAGTTCGTGAGTTCCAGGACAGCCAGGGCTA 481 CACAGAGAAACCCTGTCTCGAAAAACCAAAAAAAAAAAAAAAAAAAAAGAGGAGGAAGGAGGGGGAAAAAGGAAGCCTGG 561 GGTTTTATACCAAAATGTGAGTTTTTTTTTGTGAGTCAGAGAAGTGAGAGGATTTAAATACATATCTATTTAGAGGTTAT 641 TAGCAGGAGTATGCCGAAAGGATCGGAGTCTAAACTGGTACCCTAGCATTTCAAAGGTCCTCAACAGATACTTAACAAAA 721 AGTTCCAGAGCATCACCTTATAACTAATAGCACCTGTATGGTACAGAGCTGTAAGGTACAAGGTTTTTTGTTTCAGCAAA 801 ATTCACGATGACCAATGGGAAACAATCTAGGCTTTCTGGGGGGCGGGCAGGGGATGGATGAATAAAGCTAGGGATACATC 881 CGCATGATGAAGTTCTAGCTCGCCAACCATAAAAAGGCAAGTTCCAGGCGAAGACTGCTTTAGATATTGAACGTCTCTGC 961 GACCCAGGAGCAGCAGATGGTAGAACTACTCTCCCTATACATGAGTATGGACTGTTTGGTTTTTCAAAATGGAAACACCA 1041 TGATGTTGACGATAGCTGCCTCAGGGCTGAAAACAAGCAATGGCACAGTGGGTGACTGTTACTGTTTGTGTTTGCATTTT 1121 CCAGAGTTTTCACCATGACTGTATTTTGCAGGACACATTTATAAACATTAATAAACACTATTTTTAGAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | mESCs | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM622570. RNA binding protein: AGO2. Condition:WT1A
HITS-CLIP data was present in GSM622573. RNA binding protein: AGO2. Condition:KO1
HITS-CLIP data was present in GSM622574. RNA binding protein: AGO2. Condition:KO2
... - Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Leung AK; Young AG; Bhutkar A; Zheng GX; et al. - Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | C2C12 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast
HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes
... - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell. |
| Article |
- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al. - Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
|
| CLIP-seq Support 1 for dataset GSM4751756 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | adipose tissue / RNA sequencing of iBAT 1 |
| Location of target site | NM_008350 | 3UTR | AGGACAGCCAGGGCUACACAGAGAAACCCUGUCUCGAAAAACCAAAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE142677 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM4751757 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | adipose tissue / RNA sequencing of iBAT 2 |
| Location of target site | NM_008350 | 3UTR | CCAGGACAGCCAGGGCUACACAGAGAAACCCUGUCUCGAAAAACCAAAAAAAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE142677 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM4751759 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | adipose tissue / RNA sequencing of iBAT 4 |
| Location of target site | NM_008350 | 3UTR | CAGGACAGCCAGGGCUACACAGAGAAACCCUGUCUCGAAAAACCAAAAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE142677 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM622570 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | mESCs / WT1A |
| Location of target site | NM_008350 | 3UTR | AGGGCUACACAGAGAAACCCUGUCUCGAAAAAC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21258322 / GSE25310 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM622573 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | mESCs / KO1 |
| Location of target site | NM_008350 | 3UTR | ACACAGAGAAACCCUGUCUCGAAAAAC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21258322 / GSE25310 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM622574 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | mESCs / KO2 |
| Location of target site | NM_008350 | 3UTR | AGGGCUACACAGAGAAACCCUGUCUCGAAAAACC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21258322 / GSE25310 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM1385342 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | C2C12 / C2C12_GM_Ago2_CLIP-Seq_myoblast |
| Location of target site | NM_008350 | 3UTR | AGUUCGUGAGUUCCAGGACAGCCAGGGCUACACAGAGAAACCCUGUCUCGAAAAACCAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 25083871 / GSE57596 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset GSM1385343 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | C2C12 / C2C12_DM_Ago2_CLIP-Seq_myotubes |
| Location of target site | NM_008350 | 3UTR | AGUUCGUGAGUUCCAGGACAGCCAGGGCUACACAGAGAAACCCUGUCUCGAAAAACCA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 25083871 / GSE57596 |
| CLIP-seq Viewer | Link |
154 mmu-miR-129-1-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT577374 | Ybey | ybeY metallopeptidase |  |
|
2 | 4 | ||||||
| MIRT577528 | Tirap | toll-interleukin 1 receptor (TIR) domain-containing adaptor protein | |
|
2 | 4 | ||||||
| MIRT577536 | Timm17b | translocase of inner mitochondrial membrane 17b | |
|
2 | 4 | ||||||
| MIRT577611 | Stxbp4 | syntaxin binding protein 4 | |
|
2 | 2 | ||||||
| MIRT577653 | Smyd4 | SET and MYND domain containing 4 | |
|
2 | 4 | ||||||
| MIRT577661 | Slc6a2 | solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 | |
|
2 | 4 | ||||||
| MIRT578366 | Lrrc14b | leucine rich repeat containing 14B | |
|
2 | 4 | ||||||
| MIRT579042 | Csf3r | colony stimulating factor 3 receptor (granulocyte) | |
|
2 | 2 | ||||||
| MIRT579177 | Cd3eap | CD3E antigen, epsilon polypeptide associated protein | |
|
2 | 4 | ||||||
| MIRT579526 | 9230110C19Rik | RIKEN cDNA 9230110C19 gene | |
|
2 | 2 | ||||||
| MIRT579583 | Uvssa | UV stimulated scaffold protein A | |
1 | 1 | |||||||
| MIRT579590 | 4930579G24Rik | RIKEN cDNA 4930579G24 gene | |
|
2 | 4 | ||||||
| MIRT579674 | Inip | INTS3 and NABP interacting protein | |
1 | 2 | |||||||
| MIRT579681 | Ccdc167 | coiled-coil domain containing 167 | |
1 | 1 | |||||||
| MIRT579809 | Zfp148 | zinc finger protein 148 | |
|
2 | 4 | ||||||
| MIRT580341 | Tmod1 | tropomodulin 1 | |
|
2 | 2 | ||||||
| MIRT580436 | Tmed5 | transmembrane p24 trafficking protein 5 | |
|
2 | 2 | ||||||
| MIRT580518 | Tet1 | tet methylcytosine dioxygenase 1 | |
|
2 | 2 | ||||||
| MIRT581179 | Scn8a | sodium channel, voltage-gated, type VIII, alpha | |
|
2 | 4 | ||||||
| MIRT581283 | Rp2h | retinitis pigmentosa 2 homolog | |
|
2 | 4 | ||||||
| MIRT582042 | Otud7b | OTU domain containing 7B | |
|
2 | 4 | ||||||
| MIRT582293 | Nav2 | neuron navigator 2 | |
|
2 | 2 | ||||||
| MIRT582403 | Mprip | myosin phosphatase Rho interacting protein | |
|
2 | 2 | ||||||
| MIRT582579 | Lypla1 | lysophospholipase 1 | |
|
2 | 2 | ||||||
| MIRT582607 | Lrrc3 | leucine rich repeat containing 3 | |
|
2 | 4 | ||||||
| MIRT582823 | Iws1 | IWS1, SUPT6 interacting protein | |
|
2 | 4 | ||||||
| MIRT582933 | Il11 | interleukin 11 | |
|
2 | 4 | ||||||
| MIRT583276 | Gm6531 | CDC28 protein kinase 1b, retrogene | |
|
2 | 4 | ||||||
| MIRT583359 | Gad2 | glutamic acid decarboxylase 2 | |
|
2 | 4 | ||||||
| MIRT584153 | Creb1 | cAMP responsive element binding protein 1 | |
|
2 | 2 | ||||||
| MIRT584172 | Cpox | coproporphyrinogen oxidase | |
|
2 | 2 | ||||||
| MIRT584306 | Chic1 | cysteine-rich hydrophobic domain 1 | |
|
2 | 4 | ||||||
| MIRT584544 | Btaf1 | B-TFIID TATA-box binding protein associated factor 1 | |
|
2 | 2 | ||||||
| MIRT584612 | BC030476 | glutamate rich 5 | |
|
2 | 4 | ||||||
| MIRT584770 | Asap3 | ArfGAP with SH3 domain, ankyrin repeat and PH domain 3 | |
|
2 | 2 | ||||||
| MIRT584946 | Adarb1 | adenosine deaminase, RNA-specific, B1 | |
|
2 | 4 | ||||||
| MIRT585126 | Zfp933 | zinc finger protein 933 | |
|
2 | 4 | ||||||
| MIRT585139 | Zfp882 | zinc finger protein 882 | |
|
2 | 4 | ||||||
| MIRT585209 | Zfp553 | zinc finger protein 553 | |
|
2 | 4 | ||||||
| MIRT585374 | Xcr1 | chemokine (C motif) receptor 1 | |
|
2 | 2 | ||||||
| MIRT585439 | Veph1 | ventricular zone expressed PH domain-containing 1 | |
|
2 | 4 | ||||||
| MIRT585463 | Ube2c | ubiquitin-conjugating enzyme E2C | |
|
2 | 4 | ||||||
| MIRT585561 | Tprkb | Tp53rk binding protein | |
|
2 | 2 | ||||||
| MIRT585676 | Tfcp2l1 | transcription factor CP2-like 1 | |
1 | 1 | |||||||
| MIRT585779 | Spc24 | SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) | |
|
2 | 2 | ||||||
| MIRT585868 | Slc23a1 | solute carrier family 23 (nucleobase transporters), member 1 | |
|
2 | 2 | ||||||
| MIRT585899 | Slc17a8 | solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 | |
|
2 | 4 | ||||||
| MIRT585972 | Sgpp2 | sphingosine-1-phosphate phosphotase 2 | |
|
2 | 4 | ||||||
| MIRT585990 | Sfxn2 | sideroflexin 2 | |
|
2 | 2 | ||||||
| MIRT586068 | Rhobtb1 | Rho-related BTB domain containing 1 | |
|
2 | 2 | ||||||
| MIRT586089 | Rft1 | RFT1 homolog | |
|
2 | 2 | ||||||
| MIRT586161 | Pus7 | pseudouridylate synthase 7 | |
|
2 | 2 | ||||||
| MIRT586201 | Ptpn7 | protein tyrosine phosphatase, non-receptor type 7 | |
|
2 | 2 | ||||||
| MIRT586228 | Psmd9 | proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 | |
|
2 | 2 | ||||||
| MIRT586240 | Psmb11 | proteasome (prosome, macropain) subunit, beta type, 11 | |
|
2 | 2 | ||||||
| MIRT586256 | Prss43 | protease, serine 43 | |
|
2 | 4 | ||||||
| MIRT586361 | Pdk1 | pyruvate dehydrogenase kinase, isoenzyme 1 | |
|
2 | 4 | ||||||
| MIRT586433 | Nwd1 | NACHT and WD repeat domain containing 1 | |
|
2 | 2 | ||||||
| MIRT586522 | Ndor1 | NADPH dependent diflavin oxidoreductase 1 | |
|
2 | 2 | ||||||
| MIRT586601 | Mob3c | MOB kinase activator 3C | |
1 | 1 | |||||||
| MIRT586637 | Mettl2 | methyltransferase like 2 | |
|
2 | 4 | ||||||
| MIRT586649 | Med16 | mediator complex subunit 16 | |
|
2 | 4 | ||||||
| MIRT586712 | Lmbrd1 | LMBR1 domain containing 1 | |
|
2 | 2 | ||||||
| MIRT586754 | Kif1c | kinesin family member 1C | |
|
2 | 4 | ||||||
| MIRT586876 | Hyal1 | hyaluronoglucosaminidase 1 | |
|
2 | 2 | ||||||
| MIRT586894 | Hsbp1l1 | heat shock factor binding protein 1-like 1 | |
|
2 | 4 | ||||||
| MIRT586970 | Gprc5c | G protein-coupled receptor, family C, group 5, member C | |
|
2 | 2 | ||||||
| MIRT587001 | Gpi1 | glucose phosphate isomerase 1 | |
|
2 | 2 | ||||||
| MIRT587030 | Gmip | Gem-interacting protein | |
|
2 | 4 | ||||||
| MIRT587078 | Glt28d2 | glycosyltransferase 28 domain containing 2 | |
|
2 | 2 | ||||||
| MIRT587084 | Glrx2 | glutaredoxin 2 (thioltransferase) | |
|
2 | 2 | ||||||
| MIRT587110 | Gga2 | golgi associated, gamma adaptin ear containing, ARF binding protein 2 | |
|
2 | 4 | ||||||
| MIRT587136 | Gemin8 | gem nuclear organelle associated protein 8 | |
|
2 | 4 | ||||||
| MIRT587209 | Fbxo22 | F-box protein 22 | |
|
2 | 2 | ||||||
| MIRT587288 | F10 | coagulation factor X | |
|
2 | 2 | ||||||
| MIRT587366 | E130311K13Rik | RIKEN cDNA E130311K13 gene | |
|
2 | 4 | ||||||
| MIRT587685 | Cdh1 | cadherin 1 | |
|
2 | 4 | ||||||
| MIRT587831 | Casp8 | caspase 8 | |
|
2 | 2 | ||||||
| MIRT587890 | BC026590 | family with sequence similarity 206, member A | |
|
2 | 2 | ||||||
| MIRT587914 | Bambi | BMP and activin membrane-bound inhibitor | |
|
2 | 2 | ||||||
| MIRT587925 | B4galnt2 | beta-1,4-N-acetyl-galactosaminyl transferase 2 | |
|
2 | 4 | ||||||
| MIRT587936 | Atpbd4 | diphthamine biosynthesis 6 | |
|
2 | 4 | ||||||
| MIRT587999 | Alox12 | arachidonate 12-lipoxygenase | |
|
2 | 4 | ||||||
| MIRT588045 | Aida | axin interactor, dorsalization associated | |
|
2 | 4 | ||||||
| MIRT588085 | Agtrap | angiotensin II, type I receptor-associated protein | |
|
2 | 2 | ||||||
| MIRT588096 | Afg3l1 | AFG3-like AAA ATPase 1 | |
|
2 | 4 | ||||||
| MIRT588129 | Abcd4 | ATP-binding cassette, sub-family D (ALD), member 4 | |
|
2 | 2 | ||||||
| MIRT588170 | Rmi2 | RecQ mediated genome instability 2 | |
1 | 1 | |||||||
| MIRT588242 | Ndufaf7 | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex assembly factor 7 | |
1 | 1 | |||||||
| MIRT588327 | Zfyve27 | zinc finger, FYVE domain containing 27 | |
|
2 | 4 | ||||||
| MIRT588352 | Zfp568 | zinc finger protein 568 | |
|
2 | 2 | ||||||
| MIRT588404 | Zdhhc20 | zinc finger, DHHC domain containing 20 | |
|
2 | 2 | ||||||
| MIRT588707 | Tecpr2 | tectonin beta-propeller repeat containing 2 | |
|
2 | 2 | ||||||
| MIRT589367 | Ogdh | oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) | |
|
2 | 4 | ||||||
| MIRT589444 | Ncl | nucleolin | |
|
2 | 4 | ||||||
| MIRT589531 | Mob4 | MOB family member 4, phocein | |
1 | 1 | |||||||
| MIRT589565 | Mau2 | MAU2 sister chromatid cohesion factor | |
|
2 | 2 | ||||||
| MIRT589582 | Magt1 | magnesium transporter 1 | |
|
2 | 4 | ||||||
| MIRT589727 | Kif11 | kinesin family member 11 | |
|
2 | 2 | ||||||
| MIRT590244 | Diap2 | diaphanous related formin 2 | |
|
2 | 4 | ||||||
| MIRT590282 | Dcp2 | decapping mRNA 2 | |
|
2 | 2 | ||||||
| MIRT590303 | Cxcl11 | chemokine (C-X-C motif) ligand 11 | |
|
2 | 2 | ||||||
| MIRT590350 | Cntn2 | contactin 2 | |
|
2 | 4 | ||||||
| MIRT590451 | Car5b | carbonic anhydrase 5b, mitochondrial | |
|
2 | 2 | ||||||
| MIRT590775 | 5730455P16Rik | RIKEN cDNA 5730455P16 gene | |
|
2 | 2 | ||||||
| MIRT590785 | Epg5 | ectopic P-granules autophagy protein 5 homolog (C. elegans) | |
1 | 1 | |||||||
| MIRT596490 | Zfp959 | zinc finger protein 959 | |
|
2 | 2 | ||||||
| MIRT596696 | Zbtb8b | zinc finger and BTB domain containing 8b | |
|
2 | 2 | ||||||
| MIRT596734 | Wdfy1 | WD repeat and FYVE domain containing 1 | |
|
2 | 2 | ||||||
| MIRT596782 | Ubxn8 | UBX domain protein 8 | |
|
2 | 2 | ||||||
| MIRT596943 | Tmppe | transmembrane protein with metallophosphoesterase domain | |
|
2 | 2 | ||||||
| MIRT597221 | Slc7a2 | solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 | |
|
2 | 2 | ||||||
| MIRT597371 | Sap18 | Sin3-associated polypeptide 18 | |
|
2 | 2 | ||||||
| MIRT597391 | Rsad1 | radical S-adenosyl methionine domain containing 1 | |
|
2 | 2 | ||||||
| MIRT597748 | Pogk | pogo transposable element with KRAB domain | |
|
2 | 2 | ||||||
| MIRT597819 | Pkd2 | polycystic kidney disease 2 | |
|
2 | 2 | ||||||
| MIRT597872 | Pdxdc1 | pyridoxal-dependent decarboxylase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT597993 | Npy1r | neuropeptide Y receptor Y1 | |
|
2 | 2 | ||||||
| MIRT598186 | Mrpl19 | mitochondrial ribosomal protein L19 | |
|
2 | 2 | ||||||
| MIRT598676 | Hltf | helicase-like transcription factor | |
|
2 | 2 | ||||||
| MIRT598700 | Haus2 | HAUS augmin-like complex, subunit 2 | |
|
2 | 2 | ||||||
| MIRT598897 | Gla | galactosidase, alpha | |
|
2 | 2 | ||||||
| MIRT599113 | Ecd | ecdysoneless homolog (Drosophila) | |
|
2 | 2 | ||||||
| MIRT599289 | Cxcr2 | chemokine (C-X-C motif) receptor 2 | |
|
2 | 2 | ||||||
| MIRT599320 | Comt | catechol-O-methyltransferase | |
|
2 | 2 | ||||||
| MIRT599376 | Cml3 | N-acetyltransferase 8 (GCN5-related) family member 3 | |
|
2 | 2 | ||||||
| MIRT599495 | Ccdc78 | coiled-coil domain containing 78 | |
|
2 | 2 | ||||||
| MIRT599730 | Anapc16 | anaphase promoting complex subunit 16 | |
|
2 | 2 | ||||||
| MIRT600302 | Taf1 | TATA-box binding protein associated factor 1 | |
|
2 | 2 | ||||||
| MIRT600940 | Elk1 | ELK1, member of ETS oncogene family | |
|
2 | 2 | ||||||
| MIRT601239 | Abl2 | v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) | |
|
2 | 2 | ||||||
| MIRT601595 | Slx1b | SLX1 structure-specific endonuclease subunit homolog B (S. cerevisiae) | |
|
2 | 2 | ||||||
| MIRT601758 | Rapgef4 | Rap guanine nucleotide exchange factor (GEF) 4 | |
|
2 | 2 | ||||||
| MIRT601823 | Prpf31 | pre-mRNA processing factor 31 | |
|
2 | 2 | ||||||
| MIRT601838 | Polr3f | polymerase (RNA) III (DNA directed) polypeptide F | |
|
2 | 2 | ||||||
| MIRT601913 | Opa3 | optic atrophy 3 | |
|
2 | 2 | ||||||
| MIRT602113 | Krr1 | KRR1, small subunit (SSU) processome component, homolog (yeast) | |
|
2 | 2 | ||||||
| MIRT602125 | Klhl24 | kelch-like 24 | |
|
2 | 2 | ||||||
| MIRT602173 | Ifngr2 | interferon gamma receptor 2 | |
|
2 | 2 | ||||||
| MIRT602382 | Fam86 | eukaryotic elongation factor 2 lysine methyltransferase | |
|
2 | 2 | ||||||
| MIRT602466 | Dnal1 | dynein, axonemal, light chain 1 | |
1 | 1 | |||||||
| MIRT602570 | Crtc3 | CREB regulated transcription coactivator 3 | |
|
2 | 2 | ||||||
| MIRT603746 | Mpv17 | MpV17 mitochondrial inner membrane protein | |
|
2 | 2 | ||||||
| MIRT604411 | Adam28 | a disintegrin and metallopeptidase domain 28 | |
|
2 | 2 | ||||||
| MIRT604653 | Snx30 | sorting nexin family member 30 | |
|
2 | 2 | ||||||
| MIRT605138 | Clmn | calmin | |
|
2 | 2 | ||||||
| MIRT605173 | Bri3bp | Bri3 binding protein | |
|
2 | 2 | ||||||
| MIRT605632 | Mfsd11 | major facilitator superfamily domain containing 11 | |
|
2 | 2 | ||||||
| MIRT605648 | Mapre1 | microtubule-associated protein, RP/EB family, member 1 | |
|
2 | 2 | ||||||
| MIRT605835 | Cd300a | CD300A molecule | |
|
2 | 2 | ||||||
| MIRT605892 | 2010109I03Rik | RIKEN cDNA 2010109I03 gene | |
|
2 | 2 | ||||||
| MIRT605992 | Lima1 | LIM domain and actin binding 1 | |
|
2 | 2 | ||||||
| MIRT606568 | Tstd3 | thiosulfate sulfurtransferase (rhodanese)-like domain containing 3 | |
1 | 1 | |||||||
| MIRT606612 | Sfn | stratifin | |
|
2 | 2 | ||||||