miRTarBase - #MIRT584403


—
pre-miRNA Information
pre-miRNA mmu-mir-5114   
Genomic Coordinates chr19: 44303171 - 44303231
Description Mus musculus miR-5114 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-5114
Sequence 1| ACUGGAGACGGAAGCUGCAAGA |22
Evidence Experimental
Experiments Illumina
Putative Targets

Gene Information
Gene Symbol Cd63   
Synonyms C75951, ME491, Tspan30
Description CD63 antigen
Transcript NM_001042580   
Other Transcripts NM_007653   
Expression
Putative miRNA Targets on Cd63
3'UTR of Cd63
(miRNA target sites are highlighted)		 
>Cd63|NM_001042580|3'UTR
   1 GGGTGGGGGGCGTTTGGTCTTTTCATGGAGTGGATTCTCCAGGTTTTTCAATTAAACGGATTATTTTTTCAGACCTAAAA
  81 AAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agaACGUCGAAGGCAGAGGUCa 5'
             || || |    ||||||| 
Target 5' tcaTGGAG-TGGATTCTCCAGg 3'
 23 - 43 142.00 -13.80
2 
miRNA  3' agaacGUCGAAGGCAGAGGUCa 5'
               |:| || : |:|:||| 
Target 5' ttaaaCGGATTATTTTTTCAGa 3'
 52 - 73 121.00 -8.00
3 
miRNA  3' agaaCGUCG-AAGGCAGagguca 5'
              | :|| ||: |||      
Target 5' gtggGGGGCGTTTGGTCttttca 3'
 3 - 25 58.00 -9.82
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agaacGUCGAAGGCAGAGGUCa 5'
               |:| || : |:|:||| 
Target 5' uuaaaCGGAUUAUUUUUUCAGa 3'
 		12 - 33
Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
CLIP-seq Support 1 for dataset GSM1385343
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_DM_Ago2_CLIP-Seq_myotubes
Location of target site NM_001042580 | 3UTR | AGGUUUUUCAAUUAAACGGAUUAUUUUUUCAGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
39 mmu-miR-5114 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT577166 Madd MAP-kinase activating death domain 2 12
MIRT580377 Tmem206 transmembrane protein 206 2 4
MIRT580729 Srrm4 serine/arginine repetitive matrix 4 2 2
MIRT581165 Sec23ip Sec23 interacting protein 2 2
MIRT581310 Rnf150 ring finger protein 150 2 4
MIRT581568 Prtg protogenin 2 2
MIRT582280 Nav2 neuron navigator 2 2 2
MIRT582511 March5 membrane-associated ring finger (C3HC4) 5 2 4
MIRT584183 Cpeb3 cytoplasmic polyadenylation element binding protein 3 2 2
MIRT584252 Cmtm6 CKLF-like MARVEL transmembrane domain containing 6 2 2
MIRT584403 Cd63 CD63 antigen 2 2
MIRT586848 Ikbkg inhibitor of kappaB kinase gamma 2 4
MIRT586939 H2-T24 histocompatibility 2, T region locus 24 2 4
MIRT587266 Fam161b family with sequence similarity 161, member B 2 2
MIRT588386 Zfp113 zinc finger protein 113 2 2
MIRT590219 Dync1li2 dynein, cytoplasmic 1 light intermediate chain 2 2 4
MIRT592159 Paxip1 PAX interacting (with transcription-activation domain) protein 1 2 2
MIRT592188 Nanog Nanog homeobox 2 4
MIRT593309 Rmnd5a required for meiotic nuclear division 5 homolog A 2 2
MIRT594051 1200014J11Rik nuclear cap binding subunit 3 2 2
MIRT594495 Cspg4 chondroitin sulfate proteoglycan 4 2 2
MIRT595572 Mtf1 metal response element binding transcription factor 1 2 2
MIRT597122 Svopl SV2 related protein homolog (rat)-like 2 2
MIRT598947 Ggps1 geranylgeranyl diphosphate synthase 1 2 2
MIRT599498 Ccdc78 coiled-coil domain containing 78 2 2
MIRT601067 Cdc14b CDC14 cell division cycle 14B 2 2
MIRT601902 Padi2 peptidyl arginine deiminase, type II 2 2
MIRT602607 Chrna1 cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) 2 2
MIRT602771 Armc2 armadillo repeat containing 2 2 2
MIRT602877 4931428F04Rik RIKEN cDNA 4931428F04 gene 2 2
MIRT602958 Xpo7 exportin 7 2 2
MIRT603304 Slc4a7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 2 2
MIRT603315 Slc35d2 solute carrier family 35, member D2 2 2
MIRT603389 Sgol2 shugoshin 2A 2 2
MIRT605052 Efr3b EFR3 homolog B 2 2
MIRT605054 Arhgef39 Rho guanine nucleotide exchange factor (GEF) 39 1 1
MIRT605412 T2 brachyury 2 2 2
MIRT605550 Ppp1r16b protein phosphatase 1, regulatory (inhibitor) subunit 16B 2 2
MIRT606407 Glrx2 glutaredoxin 2 (thioltransferase) 2 2

Error report submission