miRTarBase - #MIRT584702


—
pre-miRNA Information
pre-miRNA mmu-mir-3110   
Genomic Coordinates chrX: 38210441 - 38210520
Description Mus musculus miR-3110 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-3110-5p
Sequence 13| UUCUGCCUCCCCUGAAGGCUC |33
Evidence Experimental
Experiments Illumina
Putative Targets

Gene Information
Gene Symbol Auts2   
Synonyms 2700063G02Rik, A730011F23Rik, D830032G16Rik
Description autism susceptibility candidate 2
Transcript NM_177047   
Expression
Putative miRNA Targets on Auts2
3'UTR of Auts2
(miRNA target sites are highlighted)		 
>Auts2|NM_177047|3'UTR
   1 GCCAGGAGGACAAGGCAGACCTCGGAGTGGGGGAGGAATCCCCAGGGAACCCCCCCCCCAGACTCAAGAGACAACTCCCG
  81 CACCCCTAAACTTGAGAGGTGCAGAGCTCCAACTCTTCCCCTGGAAAAAAAAAAAAAAGGACAGACACTCTGTTTGGATG
 161 TTGAAATGTTTTTGTATATTAATGTTGGAATTTTTCAGACCTTTTAGCCAGGTCTTGTTTGTTCTTACATTTCTTTACTT
 241 TTTTTGTTGTTGTTCCTTGCCTAAAACTTTGATCTGAACCAAAACGGTGAAGGTACTGACACACAGGGATCTGATGATCA
 321 CAGGGGGCGGGGCGGGGGACATCTATCCATCACCCAGAGCTGTCTCGGAGGAGGAGGCTTTGTACATAAAGTGTAAAAAG
 401 AGATTGCTTCGTGAGCTGACGGTTCATATATGCAAAAGAGAAAGACAAAAGCTTTACTTGTACAGATGTAAATAGGTAAA
 481 GAGTAAGTAACATAATACATAAATACTTCCTCAAATGTGCTATTTACAAGTCTAATATCAGTGAACCCGGCCCTCGGAGG
 561 AGGAGGCCGCGTTCCCATCTGCTAAACCCTTCAACTATGCAATGAACACGAGGGCTTTTCCCCGAAGCCCGGTTAACTCA
 641 AAGGAGCCTTTTCAAATCCATTTACAACATACTTAAGGTCATATTTTCCCTGAACAAGCGCTTACCTGAGATGTTACACA
 721 ACTGCTTTCCTTTTGGTTTGGTTTTTGTTTTTCAAATGAAGAAACACCTTTCTTTTTTTCTTTTCTTTTTTCTTTTCTTA
 801 TTTTAATCTGAAACCCAGGCTGGAACTTTGCGTCTGAAGTTGCTGCTTGTGGTCTTCTGGGGAGAAATGGGGAAAGGTCC
 881 ACCCCCTAGAAAGTGTAGCTAAGAACCGGAAGTAGCTTTGCCCAGGGAAGATGGGATTGCTCTGCCAATAATCAGGGGCA
 961 GGTGGGCTGTGTCTGCCAGCACAAACCGGTCACCAGAATTTCTGGTCACCTTTGATGGCGTAATGTTGCAGGCAACTTCA
1041 AGTGGGCACCGTGCCTCCGCAGCAACCCATGTCCTGGCTCATGACACGGAGGACACACTTCCTCGTTCCACAGTATGATT
1121 TAAGGACACTCACACGGGTCCTGAAAGAAAGCTGTCTGGGTTTTCTCAGGCGTTGGATACATTGCCACAGTAACTGAAGA
1201 AGGTACCCGGAGCCCAGTGTGAATCGTTTATATTCCAATAAGAAATGGGAAACCTGGGCAGAGCTGAGCTGAGCAGGTAG
1281 ATCTAGTAAGAGCCATCAGAAATTACCGAGGGCGAAAGAAGGCAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
1361 GAGAGAGAGAACATGCATGCACGCGCTCTTGTGTGCACTTGTGTGTGTGTGTGTGTGTGTTGTATTTTCTTCAGTCTTAA
1441 TGTCTTCATGACACTTTTATAAGGACATTAACCCTCTTGTCTACATATTTGGAGAGAATATGACTTTACTAGCCGAGAAA
1521 ATACACTATATCTTGTCTACTGGCCTGTAAAATACATGTAAGAAATAAAAATTAGCCCCATTTGGTCCTCTAGTATATTA
1601 AAGTGCTATCTGACATTGTTATCCTGTTTTTTGTTTTGTTTTATTTTCAAAAAAAAAAAAAAGTGTAAACTACAGACCAT
1681 TGTTTCTAAAAGCAGAGAGATCTATTTTAGTAGTCAACAGAAGGTTTAGTTGTGAATTCCGATTTTGTGGACAC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cucggaaGUCC-CC---UCCGUCUu 5'
                 |||| ||   ||||||| 
Target 5' -----gcCAGGAGGACAAGGCAGAc 3'
 1 - 20 150.00 -16.50
2 
miRNA  3' cucggaaguccCCUCCGUCUu 5'
                     | ||||||| 
Target 5' cgagggcgaaaGAAGGCAGAg 3'
 1307 - 1327 142.00 -15.00
3 
miRNA  3' cucggaaGUCCCCUCCGUCUu 5'
                 | | | |||:||| 
Target 5' agctgagCTGAGCAGGTAGAt 3'
 1262 - 1282 130.00 -12.40
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions mESCs
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM622570. RNA binding protein: AGO2. Condition:WT1A HITS-CLIP data was present in GSM622572. RNA binding protein: AGO2. Condition:WT2 HITS-CLIP data was present in GSM622574. RNA binding protein: AGO2. Condition:KO2 ...

- Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology.

Article - Leung AK; Young AG; Bhutkar A; Zheng GX; et al.
- Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Liver
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in ERR266281. RNA binding protein: AGO2. Condition:A_Liver partial hapatectomy 48h HITS-CLIP data was present in ERR266286. RNA binding protein: AGO2. Condition:A_Liver partial hapatectomy 1h HITS-CLIP data was present in ERR266287. RNA binding protein: AGO2. Condition:B_Liver partial hapatectomy 36h HITS-CLIP data was present in ERR266295. RNA binding protein: AGO2. Condition:B_Liver partial hapatectomy 1h HITS-CLIP data was present in ERR266300. RNA binding protein: AGO2. Condition:B_Untreated ...

- Schug J; McKenna LB; Walton G; Hand N; et al., 2013, BMC genomics.

Article - Schug J; McKenna LB; Walton G; Hand N; et al.
- BMC genomics, 2013
BACKGROUND: Validation of physiologic miRNA targets has been met with significant challenges. We employed HITS-CLIP to identify which miRNAs participate in liver regeneration, and to identify their target mRNAs. RESULTS: miRNA recruitment to the RISC is highly dynamic, changing more than five-fold for several miRNAs. miRNA recruitment to the RISC did not correlate with changes in overall miRNA expression for these dynamically recruited miRNAs, emphasizing the necessity to determine miRNA recruitment to the RISC in order to fully assess the impact of miRNA regulation. We incorporated RNA-seq quantification of total mRNA to identify expression-weighted Ago footprints, and developed a microRNA regulatory element (MRE) prediction algorithm that represents a greater than 20-fold refinement over computational methods alone. These high confidence MREs were used to generate candidate 'competing endogenous RNA' (ceRNA) networks. CONCLUSION: HITS-CLIP analysis provide novel insights into global miRNA:mRNA relationships in the regenerating liver.
LinkOut: [PMID: 23597149]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
185 mmu-miR-3110-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT577467 Trim72 tripartite motif-containing 72 1 1
MIRT578414 Kcnj5 potassium inwardly-rectifying channel, subfamily J, member 5 1 3
MIRT580083 Uvrag UV radiation resistance associated gene 1 1
MIRT581091 Sept9 septin 9 1 2
MIRT581465 Rad51d RAD51 paralog D 1 2
MIRT584702 Auts2 autism susceptibility candidate 2 1 3
MIRT585267 Zfp397 zinc finger protein 397 1 1
MIRT585320 Zfp111 zinc finger protein 111 1 1
MIRT585381 Xcr1 chemokine (C motif) receptor 1 1 2
MIRT585457 Ubxn2a UBX domain protein 2A 1 2
MIRT585569 Tprkb Tp53rk binding protein 1 2
MIRT585601 Tns4 tensin 4 1 2
MIRT585672 Timm17b translocase of inner mitochondrial membrane 17b 1 1
MIRT585714 Taf1a TATA-box binding protein associated factor, RNA polymerase I, A 1 2
MIRT585718 Taf1 TATA-box binding protein associated factor 1 1 1
MIRT586060 Rnf168 ring finger protein 168 1 2
MIRT586208 Ptpn7 protein tyrosine phosphatase, non-receptor type 7 1 2
MIRT586593 Mpv17 MpV17 mitochondrial inner membrane protein 1 1
MIRT586642 Mettl2 methyltransferase like 2 1 2
MIRT586700 Lrrc3 leucine rich repeat containing 3 1 1
MIRT586976 Gprc5c G protein-coupled receptor, family C, group 5, member C 1 1
MIRT587114 Gga2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 1 2
MIRT587174 Gad2 glutamic acid decarboxylase 2 1 1
MIRT587183 Ftsj1 FtsJ RNA methyltransferase homolog 1 (E. coli) 1 2
MIRT587214 Fbxo22 F-box protein 22 1 1
MIRT587305 Erich1 glutamate rich 1 1 2
MIRT587374 E130311K13Rik RIKEN cDNA E130311K13 gene 1 1
MIRT587521 Cycs cytochrome c, somatic 1 1
MIRT587570 Csf3r colony stimulating factor 3 receptor (granulocyte) 1 1
MIRT587650 Chek2 checkpoint kinase 2 1 2
MIRT587696 Cd8b1 CD8 antigen, beta chain 1 1 2
MIRT587813 Ccdc78 coiled-coil domain containing 78 1 2
MIRT587858 Car5a carbonic anhydrase 5a, mitochondrial 1 2
MIRT587862 Cand2 cullin-associated and neddylation-dissociated 2 (putative) 1 1
MIRT588103 Adsl adenylosuccinate lyase 1 1
MIRT588139 A830018L16Rik RIKEN cDNA A830018L16 gene 1 2
MIRT588212 4930579G24Rik RIKEN cDNA 4930579G24 gene 1 2
MIRT588310 Inip INTS3 and NABP interacting protein 1 2
MIRT588719 Tcea1 transcription elongation factor A (SII) 1 1 2
MIRT589501 Myo1e myosin IE 1 2
MIRT589554 Mfhas1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT589585 Magt1 magnesium transporter 1 1 2
MIRT589967 Gabpb2 GA repeat binding protein, beta 2 1 2
MIRT590357 Clmn calmin 1 2
MIRT590484 Camk4 calcium/calmodulin-dependent protein kinase IV 1 2
MIRT590745 Adarb1 adenosine deaminase, RNA-specific, B1 1 2
MIRT590790 Epg5 ectopic P-granules autophagy protein 5 homolog (C. elegans) 1 1
MIRT591781 Peli2 pellino 2 1 1
MIRT592318 Dnlz DNL-type zinc finger 1 1
MIRT593952 Cpm carboxypeptidase M 1 1
MIRT596485 Zmym5 zinc finger, MYM-type 5 1 1
MIRT596505 Zfp933 zinc finger protein 933 1 1
MIRT596516 Zfp882 zinc finger protein 882 1 1
MIRT596537 Zfp866 zinc finger protein 866 1 1
MIRT596557 Zfp811 zinc finger protein 811 1 1
MIRT596660 Zfp329 zinc finger protein 329 1 1
MIRT596687 Zbtb9 zinc finger and BTB domain containing 9 1 1
MIRT596760 Usp45 ubiquitin specific petidase 45 1 1
MIRT596890 Trp53rk transformation related protein 53 regulating kinase B 1 1
MIRT597270 Slc25a34 solute carrier family 25, member 34 1 1
MIRT597278 Slc23a1 solute carrier family 23 (nucleobase transporters), member 1 1 1
MIRT597352 Sass6 SAS-6 centriolar assembly protein 1 1
MIRT597409 Rprd1a regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT597423 Rp2h retinitis pigmentosa 2 homolog 1 1
MIRT597454 Rhag Rhesus blood group-associated A glycoprotein 1 1
MIRT597480 Rft1 RFT1 homolog 1 1
MIRT597540 Rangap1 RAN GTPase activating protein 1 1 1
MIRT597561 Rab27a RAB27A, member RAS oncogene family 1 1
MIRT597684 Ppp2r3d protein phosphatase 2 (formerly 2A), regulatory subunit B'', delta 1 1
MIRT597811 Pla2g2d phospholipase A2, group IID 1 1
MIRT597827 Pik3c2a phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 1 1
MIRT597879 Pdk1 pyruvate dehydrogenase kinase, isoenzyme 1 1 1
MIRT597997 Npy1r neuropeptide Y receptor Y1 1 1
MIRT598022 Nol10 nucleolar protein 10 1 1
MIRT598086 Nek7 NIMA (never in mitosis gene a)-related expressed kinase 7 1 1
MIRT598181 Mrpl19 mitochondrial ribosomal protein L19 1 1
MIRT598225 Mob4 MOB family member 4, phocein 1 1
MIRT598246 Mlh3 mutL homolog 3 1 1
MIRT598273 Med16 mediator complex subunit 16 1 1
MIRT598297 Mc1r melanocortin 1 receptor 1 1
MIRT598335 Mau2 MAU2 sister chromatid cohesion factor 1 1
MIRT598428 Lpl lipoprotein lipase 1 1
MIRT598500 Kcnn1 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 1 1
MIRT598610 Il11 interleukin 11 1 1
MIRT598615 Ifngr2 interferon gamma receptor 2 1 1
MIRT598701 Haus2 HAUS augmin-like complex, subunit 2 1 1
MIRT598771 Gpr157 G protein-coupled receptor 157 1 1
MIRT598813 Gm4951 predicted gene 4951 1 1
MIRT598866 Glyctk glycerate kinase 1 1
MIRT598878 Glrx2 glutaredoxin 2 (thioltransferase) 1 1
MIRT598957 Gemin8 gem nuclear organelle associated protein 8 1 1
MIRT599184 Dennd4c DENN/MADD domain containing 4C 1 1
MIRT599190 Ddx3y DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 1 1
MIRT599246 Tmem245 transmembrane protein 245 1 1
MIRT599567 Btc betacellulin, epidermal growth factor family member 1 1
MIRT599686 Arl16 ADP-ribosylation factor-like 16 1 1
MIRT599813 Agtrap angiotensin II, type I receptor-associated protein 1 1
MIRT599930 Rmi2 RecQ mediated genome instability 2 1 1
MIRT600028 Tstd3 thiosulfate sulfurtransferase (rhodanese)-like domain containing 3 1 1
MIRT600035 Ndufaf7 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex assembly factor 7 1 1
MIRT600119 Zfyve27 zinc finger, FYVE domain containing 27 1 1
MIRT600135 Zfp553 zinc finger protein 553 1 1
MIRT600136 Zfp316 zinc finger protein 316 1 1
MIRT600279 Tmem69 transmembrane protein 69 1 1
MIRT600428 Samd8 sterile alpha motif domain containing 8 1 1
MIRT600535 Pdzd2 PDZ domain containing 2 1 1
MIRT600627 Mprip myosin phosphatase Rho interacting protein 1 1
MIRT600687 Lrrc8e leucine rich repeat containing 8 family, member E 1 1
MIRT600766 Ints6 integrator complex subunit 6 1 1
MIRT600830 Gnal guanine nucleotide binding protein, alpha stimulating, olfactory type 1 1
MIRT600947 Elf1 E74-like factor 1 1 1
MIRT601121 Bri3bp Bri3 binding protein 1 1
MIRT601159 B4galt6 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 1 1
MIRT601221 Agphd1 hydroxylysine kinase 1 1 1
MIRT601243 Abl2 v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) 1 1
MIRT601363 Ybey ybeY metallopeptidase 1 1
MIRT601487 Tmlhe trimethyllysine hydroxylase, epsilon 1 1
MIRT601549 Tbc1d24 TBC1 domain family, member 24 1 1
MIRT601576 Ssr1 signal sequence receptor, alpha 1 1
MIRT601674 Sco1 SCO1 cytochrome c oxidase assembly protein 1 1
MIRT601853 Pkd2 polycystic kidney disease 2 1 1
MIRT601930 Ogdh oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) 1 1
MIRT601943 Nwd1 NACHT and WD repeat domain containing 1 1 1
MIRT601966 Nav1 neuron navigator 1 1 1
MIRT602004 Mpp7 membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) 1 1
MIRT602083 Lrp2bp Lrp2 binding protein 1 1
MIRT602120 Kremen2 kringle containing transmembrane protein 2 1 1
MIRT602165 Il1rl1 interleukin 1 receptor-like 1 1 1
MIRT602180 Hyal1 hyaluronoglucosaminidase 1 1 1
MIRT602207 Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 1 1
MIRT602223 H2-T3 histocompatibility 2, T region locus 3 1 1
MIRT602236 Grm1 glutamate receptor, metabotropic 1 1 1
MIRT602358 Fbxl3 F-box and leucine-rich repeat protein 3 1 1
MIRT602412 F2r coagulation factor II (thrombin) receptor 1 1
MIRT602418 Ercc4 excision repair cross-complementing rodent repair deficiency, complementation group 4 1 1
MIRT602483 Dkc1 dyskeratosis congenita 1, dyskerin 1 1
MIRT602564 Csf2rb colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) 1 1
MIRT602587 Chrnb4 cholinergic receptor, nicotinic, beta polypeptide 4 1 1
MIRT602667 Car5b carbonic anhydrase 5b, mitochondrial 1 1
MIRT602752 Asxl2 additional sex combs like 2 (Drosophila) 1 1
MIRT602850 Abcd2 ATP-binding cassette, sub-family D (ALD), member 2 1 1
MIRT602893 Mettl21e methyltransferase like 21E 1 1
MIRT602907 2210016F16Rik RIKEN cDNA 2210016F16 gene 1 1
MIRT602964 Trim39 tripartite motif-containing 39 1 1
MIRT603024 Chic1 cysteine-rich hydrophobic domain 1 1 1
MIRT603063 Zfp78 zinc finger protein 78 1 1
MIRT603144 Ubxn8 UBX domain protein 8 1 1
MIRT603162 Ttc38 tetratricopeptide repeat domain 38 1 1
MIRT603198 Trappc9 trafficking protein particle complex 9 1 1
MIRT603228 Slc35g1 solute carrier family 35, member G1 1 1
MIRT603439 Rpl7l1 ribosomal protein L7-like 1 1 1
MIRT603454 Rhbdl2 rhomboid, veinlet-like 2 (Drosophila) 1 1
MIRT603504 Rab27b RAB27B, member RAS oncogene family 1 1
MIRT603516 Pxmp4 peroxisomal membrane protein 4 1 1
MIRT603519 Pwwp2a PWWP domain containing 2A 1 1
MIRT603629 Pbxip1 pre B cell leukemia transcription factor interacting protein 1 1 1
MIRT603736 Mrpl45 mitochondrial ribosomal protein L45 1 1
MIRT603807 Kif5b kinesin family member 5B 1 1
MIRT603915 Hltf helicase-like transcription factor 1 1
MIRT603980 Gna15 guanine nucleotide binding protein, alpha 15 1 1
MIRT604278 Cd22 CD22 antigen 1 1
MIRT604290 Ccdc36 coiled-coil domain containing 36 1 1
MIRT604397 Aida axin interactor, dorsalization associated 1 1
MIRT604404 Afg3l1 AFG3-like AAA ATPase 1 1 1
MIRT604522 Ccdc167 coiled-coil domain containing 167 1 1
MIRT604576 Trip4 thyroid hormone receptor interactor 4 1 1
MIRT604625 Syt11 synaptotagmin XI 1 1
MIRT604903 Jhdm1d lysine (K)-specific demethylase 7A 1 1
MIRT604931 Homer2 homer scaffolding protein 2 1 1
MIRT605037 Efr3b EFR3 homolog B 1 1
MIRT605153 C030039L03Rik zinc finger protein 607B 1 1
MIRT605288 0610009O20Rik RIKEN cDNA 0610009O20 gene 1 1
MIRT605357 Yeats2 YEATS domain containing 2 1 1
MIRT605381 Urb2 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) 1 1
MIRT605476 Slc6a2 solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 1 1
MIRT605802 Emc8 ER membrane protein complex subunit 8 1 1
MIRT605838 Cd300a CD300A molecule 1 1
MIRT605855 BC030476 glutamate rich 5 1 1
MIRT606033 Btaf1 B-TFIID TATA-box binding protein associated factor 1 1 1
MIRT606263 Pigh phosphatidylinositol glycan anchor biosynthesis, class H 1 1
MIRT606315 Mysm1 myb-like, SWIRM and MPN domains 1 1 1
MIRT606355 Kdsr 3-ketodihydrosphingosine reductase 1 1
MIRT606473 Cxcl11 chemokine (C-X-C motif) ligand 11 1 1
MIRT606516 BC026590 family with sequence similarity 206, member A 1 1
MIRT606610 Snx30 sorting nexin family member 30 1 1

Error report submission