miRTarBase - #MIRT586042


—
pre-miRNA Information
pre-miRNA mmu-mir-876   
Genomic Coordinates chr4: 36645373 - 36645453
Synonyms Mirn876, mmu-mir-876, Mir876
Description Mus musculus miR-876 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-876-5p
Sequence 11| UGGAUUUCUCUGUGAAUCACUA |32
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Rps3   
Synonyms D7Ertd795e, Rs_3
Description ribosomal protein S3
Transcript NM_012052   
Expression
Putative miRNA Targets on Rps3
3'UTR of Rps3
(miRNA target sites are highlighted)		 
>Rps3|NM_012052|3'UTR
   1 CAGGGTCTTGGCAGCTGCATCTGGAGGCATTTAATAAAATAAAGACATTTAATAAAATCTTGAACAAAGACAAGGCCTGA
  81 CTGGATTGTGTCCAGTATTCAACTGAGTTATGTTGTCTATGGAGCCATGCTTATTCTGTTGGTTTAAGCTGGAGGGCATG
 161 AGCAGAGCTGACCAGAGAAGTCATGAAGTTGGTGACCCTGTGTTGAACAATTGAGGGTTAGAAGAGCAGTTTGGTTTTGG
 241 TGCTCTTGATGGAACCCAGGTGCTTGGACATAGTAAGCACACATAAGACAGAGTAAGACTGCTGTGTCTCTGGCCTGGAG
 321 TAGTCTTTCTTGCTTTTTTTTTTTTTTTTTTTTTTCTCTAGAATGAAAGCAGATGGCCCAGCGAGTTAGGTGCTTCCTAT
 401 GAAAGCATGTGTGCTGGTTTGTCATGCACACAGCCCTGCAGGAGAGAGTATGGCAACACAGCCGCTCAGCATCCCAAGAT
 481 AAAAAGGGAGTTTCTACTGCCATTTTGAGCTTGGGAGTTTGAAATGTAAAGCCTGTCCATATGTTTTAAGGATCCATGTA
 561 TTTCTGTTTTGTTTGTTTTTCAAAACAGGGTTTCTCTGTAGCCCTGGCTGTCCTGGAACCCACTCTGTATGTAGACCAGG
 641 CTGGCCTTGAACTCAGAAATCCACCTGCCTCTGGCGATCCATATATTTCTAAGTCCTGTACTTAGACGCTGTTTTGGAAA
 721 ATTCATTTTGGAAGCATTTACTGTTGGTGTGTTTTGTGGGGAATGAATGATAGCTTGGGAATTCTTTTCTGTTTGGTGAG
 801 AGTGAAGCTGTCAGCCCGGTTGTAGCCTGGCTGGTGCTCAAAGGCTTTCTCTCATTGTCTTCACCTACGTAGCTTTACGT
 881 GGGGTAAGGACTTAAGTTACTTAAGTTGGGTGCACACTGACCATGTCCACAACCTGTTAACCAACTCTACATGATGAGTA
 961 CAGATGTACCTTTTTAGAAAGTGTTAATGTGTAGCCCTGGCTGGCCTCTGCCTCAGGGTATTATGAATAAAGTGTGCAAC
1041 CTTCATCTGGTTGATTAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aucACUAAGUGUCUCUUUAGGu 5'
             |||   ||  |||||||| 
Target 5' cctTGA---ACTCAGAAATCCa 3'
 645 - 663 152.00 -11.80
2 
miRNA  3' aucACUAAGUGUC---UCUUUAGGu 5'
             ||| | |:||   :|:|||:| 
Target 5' gaaTGAATGATAGCTTGGGAATTCt 3'
 761 - 785 127.00 -8.80
3 
miRNA  3' aucACUAAGUGUCUCUUUAGgu 5'
             |||  | |||||||:||  
Target 5' agcTGA--C-CAGAGAAGTCat 3'
 166 - 184 126.00 -13.70
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
CLIP-seq Support 1 for dataset GSM1385342
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_GM_Ago2_CLIP-Seq_myoblast
Location of target site NM_012052 | 3UTR | CUGUAUGUAGACCAGGCUGGCCUUGAACUCAGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
120 mmu-miR-876-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT577002 Gpx5 glutathione peroxidase 5 2 2
MIRT577009 Zfhx3 zinc finger homeobox 3 2 2
MIRT577023 Fndc3b fibronectin type III domain containing 3B 2 4
MIRT577452 Tspan31 tetraspanin 31 2 4
MIRT578027 Pfas phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) 2 2
MIRT578035 Pde4c phosphodiesterase 4C, cAMP specific 2 2
MIRT578432 Nmrk2 nicotinamide riboside kinase 2 1 1
MIRT579608 4930519G04Rik RIKEN cDNA 4930519G04 gene 2 4
MIRT579782 Zfp422 zinc finger protein 422 2 2
MIRT579948 Xpo7 exportin 7 2 4
MIRT581398 Rbms2 RNA binding motif, single stranded interacting protein 2 2 4
MIRT582830 Itih5 inter-alpha (globulin) inhibitor H5 2 4
MIRT584574 Bpnt1 bisphosphate 3'-nucleotidase 1 2 4
MIRT585235 Zfp459 zinc finger protein 459 2 4
MIRT585498 Ttc26 tetratricopeptide repeat domain 26 2 4
MIRT585512 Trub1 TruB pseudouridine (psi) synthase family member 1 2 4
MIRT585584 Tox4 TOX high mobility group box family member 4 2 2
MIRT585843 Slc3a2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 2 2
MIRT585865 Slc23a1 solute carrier family 23 (nucleobase transporters), member 1 2 2
MIRT586042 Rps3 ribosomal protein S3 2 2
MIRT586299 Pnpla3 patatin-like phospholipase domain containing 3 2 4
MIRT586512 Neu3 neuraminidase 3 2 2
MIRT586788 Isg20l2 interferon stimulated exonuclease gene 20-like 2 2 4
MIRT586840 Il17rd interleukin 17 receptor D 2 6
MIRT586911 Helb helicase (DNA) B 2 4
MIRT586984 Gpr157 G protein-coupled receptor 157 2 4
MIRT587011 Gngt1 guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 2 4
MIRT587338 Efcab4a calcium release activated channel regulator 2B 2 4
MIRT587594 Commd8 COMM domain containing 8 2 4
MIRT588116 Aco1 aconitase 1 2 4
MIRT589172 Rab11b RAB11B, member RAS oncogene family 2 2
MIRT589182 Ptprg protein tyrosine phosphatase, receptor type, G 2 2
MIRT589339 Ostf1 osteoclast stimulating factor 1 2 4
MIRT589353 Osbpl8 oxysterol binding protein-like 8 2 4
MIRT589489 Mzt1 mitotic spindle organizing protein 1 2 4
MIRT589817 Hnrnpab heterogeneous nuclear ribonucleoprotein A/B 2 4
MIRT590034 Fbxo43 F-box protein 43 2 2
MIRT590043 Fbxo30 F-box protein 30 2 2
MIRT590125 Ercc6 excision repair cross-complementing rodent repair deficiency, complementation group 6 2 4
MIRT590429 Cbfa2t2 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) 2 4
MIRT590994 Slc28a3 solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 2 4
MIRT592907 Mmachc methylmalonic aciduria cblC type, with homocystinuria 2 4
MIRT593321 Slc25a51 solute carrier family 25, member 51 1 2
MIRT593776 Nfic nuclear factor I/C 2 2
MIRT594578 Znrf1 zinc and ring finger 1 2 2
MIRT594903 Homer1 homer scaffolding protein 1 2 2
MIRT594907 Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 2 2
MIRT595731 B2m beta-2 microglobulin 2 2
MIRT597330 Senp5 SUMO/sentrin specific peptidase 5 2 2
MIRT597339 Sema4b sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B 2 2
MIRT597499 Rbm34 RNA binding motif protein 34 2 2
MIRT597517 Rbak RB-associated KRAB zinc finger 2 2
MIRT597664 Prkcb protein kinase C, beta 2 2
MIRT597707 Ppih peptidyl prolyl isomerase H 2 2
MIRT597733 Polr3gl polymerase (RNA) III (DNA directed) polypeptide G like 2 2
MIRT597746 Polr1b polymerase (RNA) I polypeptide B 2 2
MIRT597780 Plin3 perilipin 3 2 2
MIRT597870 Pdxk pyridoxal (pyridoxine, vitamin B6) kinase 2 2
MIRT597901 Paxip1 PAX interacting (with transcription-activation domain) protein 1 2 2
MIRT598294 Mcm5 minichromosome maintenance complex component 5 2 2
MIRT598361 Man2a2 mannosidase 2, alpha 2 2 2
MIRT598747 Gpr68 G protein-coupled receptor 68 2 2
MIRT598915 Gje1 gap junction protein, epsilon 1 2 2
MIRT598934 Git2 G protein-coupled receptor kinase-interactor 2 2 2
MIRT598997 Fnip2 folliculin interacting protein 2 2 2
MIRT599120 Dynll1 dynein light chain LC8-type 1 2 2
MIRT599129 Dync1li1 dynein cytoplasmic 1 light intermediate chain 1 2 2
MIRT599209 Ddhd2 DDHD domain containing 2 2 2
MIRT599270 D14Abb1e family with sequence similarity 208, member A 2 2
MIRT599457 Cdnf cerebral dopamine neurotrophic factor 2 2
MIRT599491 Ccr9 chemokine (C-C motif) receptor 9 2 2
MIRT599545 Car5b carbonic anhydrase 5b, mitochondrial 2 2
MIRT599692 Aqp7 aquaporin 7 2 2
MIRT599818 Agl amylo-1,6-glucosidase, 4-alpha-glucanotransferase 2 2
MIRT599910 Abcc9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 2 2
MIRT599936 Rmi2 RecQ mediated genome instability 2 1 1
MIRT600061 Smco1 single-pass membrane protein with coiled-coil domains 1 1 1
MIRT600068 Knop1 lysine rich nucleolar protein 1 1 1
MIRT600089 2010315B03Rik RIKEN cDNA 2010315B03 gene 2 2
MIRT600338 Strbp spermatid perinuclear RNA binding protein 2 2
MIRT600469 Rbm4 RNA binding motif protein 4 2 2
MIRT600632 Mkl2 MKL/myocardin-like 2 2 2
MIRT600647 Med18 mediator complex subunit 18 2 2
MIRT600649 Mcc mutated in colorectal cancers 2 2
MIRT600717 Kif24 kinesin family member 24 2 2
MIRT600735 Ajuba ajuba LIM protein 1 1
MIRT600803 C5ar2 complement component 5a receptor 2 1 1
MIRT600924 Exoc8 exocyst complex component 8 2 2
MIRT601088 Cbln3 cerebellin 3 precursor protein 2 2
MIRT601272 Soga1 suppressor of glucose, autophagy associated 1 1 1
MIRT601425 Tubb5 tubulin, beta 5 class I 2 2
MIRT601557 Tapbp TAP binding protein 2 2
MIRT601630 Slc2a4 solute carrier family 2 (facilitated glucose transporter), member 4 2 2
MIRT601889 Pctp phosphatidylcholine transfer protein 2 2
MIRT601917 Ooep oocyte expressed protein 2 2
MIRT602062 Luc7l2 LUC7-like 2 (S. cerevisiae) 2 2
MIRT602149 Irgm2 immunity-related GTPase family M member 2 2 2
MIRT602256 Gnl3l guanine nucleotide binding protein-like 3 (nucleolar)-like 2 2
MIRT602278 Glt8d1 glycosyltransferase 8 domain containing 1 2 2
MIRT602285 Gls glutaminase 2 2
MIRT602324 Gal3st3 galactose-3-O-sulfotransferase 3 2 2
MIRT602385 Fam198b family with sequence similarity 198, member B 2 2
MIRT602406 Fadd Fas (TNFRSF6)-associated via death domain 2 2
MIRT602905 Fam219b family with sequence similarity 219, member B 1 1
MIRT602928 Zmat3 zinc finger matrin type 3 2 2
MIRT602977 Sgms2 sphingomyelin synthase 2 2 2
MIRT603139 Ufd1l ubiquitin recognition factor in ER-associated degradation 1 2 2
MIRT603235 Tle2 transducin-like enhancer of split 2 2 2
MIRT603269 Svopl SV2 related protein homolog (rat)-like 2 2
MIRT603292 Spib Spi-B transcription factor (Spi-1/PU.1 related) 2 2
MIRT604167 Cyb5d2 cytochrome b5 domain containing 2 2 2
MIRT604190 Cts8 cathepsin 8 2 2
MIRT604320 Car8 carbonic anhydrase 8 2 2
MIRT604483 2810006K23Rik RIKEN cDNA 2810006K23 gene 2 2
MIRT604612 Tbl1xr1 transducin (beta)-like 1X-linked receptor 1 2 2
MIRT604837 Mrpl35 mitochondrial ribosomal protein L35 2 2
MIRT605042 Efr3b EFR3 homolog B 2 2
MIRT605187 Bach2 BTB and CNC homology, basic leucine zipper transcription factor 2 2 2
MIRT605488 Slc35e2 solute carrier family 35, member E2 2 2
MIRT606171 Smtnl2 smoothelin-like 2 2 2

Error report submission