>Erich1|NM_001034862|3'UTR
   1 GATCAGCATCACCTAAGAAGAGCTGTCATGCTGGGCGTAGTGGCGCACACCTCTAATCCCAGCACTCGGGAGGCAGAGGC
  81 AGGCAGATTTCTGAGTTGGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAAAAAAACCCTGT
 161 CTCTAAAAACCAAAAAAAAAAAAAAAGAAGAGCTGTCATTTGACTCAAAGGTGTTAGTTATGCATAGGACTCGAACTCAG
 241 ACTTCATGCTTGTACATATATATGTATTTATTATTATTATTTTTGGTGAATCAAACACTGGAGACATTGAAGACATTTCT
 321 ACCACGTTATTTATTCCTGTGTTTGTATATCATAGGCAAGGTATCACCTGAGACTTGAAGTGAGAAATTGGGATAAAATG
 401 AAAGCAATTTACTTGCTTACTGTTATGTATATATTGAATTACTTCATAAAACTAGATCTTTTTTTGGTACCTGTAACAAA
 481 AGCAGATATTTTATTAAATAAACTATATAGTTTGG

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cuCGGAAGUCCCCUCCGUCUu 5' || || |||||||||| Target 5' caGCACTC--GGGAGGCAGAg 3'	60 - 78	159.00	-23.70
2	miRNA 3' cucggaaGUC-CCCUCCGUCUU----------- 5' ||| || ||||||| Target 5' cgggaggCAGAGGCAGGCAGATTTCTGAGTTGG 3'	67 - 99	126.00	-22.00
3	miRNA 3' cucGGAAGUCCCCUCCGUCUu 5' ||| :| | ||||| Target 5' gtaCCTGTAACAAAAGCAGAt 3'	467 - 487	114.00	-8.47

- Nature structural & molecular biology, 2011

MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.

- Cell, 2014

MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.