pre-miRNA Information
pre-miRNA mmu-mir-546   
Genomic Coordinates chr10: 126998440 - 126998560
Synonyms Mirn546, mmu-mir-546, Mir546
Description Mus musculus miR-546 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-546
Sequence 32| AUGGUGGCACGGAGUC |47
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Dnase2a   
Synonyms Dnase2
Description deoxyribonuclease II alpha
Transcript NM_010062   
Expression
Putative miRNA Targets on Dnase2a
3'UTR of Dnase2a
(miRNA target sites are highlighted)
>Dnase2a|NM_010062|3'UTR
   1 CTGAAGCCCATCGGAGCAAAGGACTAAGACTCCGCAGTCTAACCAGGTGGGGGCCGGACTAGCCTTTACCCCAGCACTTG
  81 GGAGGCAGAGGCAGGTGGATCGATTCTCTCTCTCTCTCTGGTTTTTCGAGACAGGGTTTCTCTGTGTAGCCTTGGCTGTC
 161 CTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCTGCTTGCCTCTGCCTCTGTCTCTTTCTCCCAAGTG
 241 CTGGGATTAAAGGCATGCGCCACCACTGCCCGGCTCAGGTGGATCTCTTGAGTTCCAGGCCAGCCTGGTCTACAGAGAGT
 321 TCCAGGAGAGCCAGGGCAACACAGAGAACCCTTGTCTCAAAGAAAAGAAGAAGAAGAAAAAAAAAGAAAAACAAGAAAAA
 401 GAGAAAAGAAAGAAAGAAAGAAAAGACTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' cugagGCACGGUGGUa 5'
               :| ||||||| 
Target 5' aggcaTGCGCCACCAc 3'
251 - 266 143.00 -14.50
2
miRNA  3' cuGAGGCACGGUGGua 5'
            :|||  |||| |  
Target 5' agTTCCAGGCCAGCct 3'
291 - 306 98.00 -12.40
3
miRNA  3' cuGAGGC-ACGG--UGGUa 5'
            |||||  |:|  |||| 
Target 5' gaCTCCGCAGTCTAACCAg 3'
28 - 46 98.00 -15.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' cugagGCACGGUGGUa 5'
               :| ||||||| 
Target 5' aggcaUGCGCCACCAc 3'
8 - 23
Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
CLIP-seq Support 1 for dataset GSM1385342
Method / RBP HITS-CLIP /  AGO2
Cell line / Condition C2C12 / C2C12_GM_Ago2_CLIP-Seq_myoblast
Location of target site NM_010062 | 3UTR | GGAUUAAAGGCAUGCGCCACCACUGCCCGGCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 25083871 / GSE57596
CLIP-seq Viewer Link
142 mmu-miR-546 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT425281 Snhg11 small nucleolar RNA host gene 11 2 2
MIRT577800 Rnmtl1 mitochondrial rRNA methyltransferase 3 2 2
MIRT578752 Gm2a GM2 ganglioside activator protein 2 2
MIRT585410 Wdr85 diphthamine biosynethesis 7 2 4
MIRT585537 Trim27 tripartite motif-containing 27 2 4
MIRT585576 Tpmt thiopurine methyltransferase 2 4
MIRT585648 Tmco3 transmembrane and coiled-coil domains 3 2 2
MIRT585854 Slc28a3 solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 2 4
MIRT586844 Ikbkg inhibitor of kappaB kinase gamma 2 4
MIRT586931 H2-T24 histocompatibility 2, T region locus 24 2 4
MIRT587006 Gnl3l guanine nucleotide binding protein-like 3 (nucleolar)-like 2 4
MIRT587401 Dnase2a deoxyribonuclease II alpha 2 2
MIRT588270 Smco1 single-pass membrane protein with coiled-coil domains 1 1 1
MIRT589551 Mga MAX gene associated 2 4
MIRT590030 Fbxo43 F-box protein 43 2 2
MIRT590120 Ercc6 excision repair cross-complementing rodent repair deficiency, complementation group 6 2 4
MIRT591419 Cd300a CD300A molecule 2 4
MIRT593669 Smarcc1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 2 2
MIRT593716 Pum2 pumilio RNA-binding family member 2 2 2
MIRT593818 Lpl lipoprotein lipase 2 2
MIRT594425 Gdf3 growth differentiation factor 3 2 4
MIRT595457 Ptrhd1 peptidyl-tRNA hydrolase domain containing 1 1 1
MIRT596195 Fyco1 FYVE and coiled-coil domain containing 1 2 2
MIRT596502 Zfp933 zinc finger protein 933 2 2
MIRT596563 Zfp799 zinc finger protein 799 2 2
MIRT596683 Zc3hav1l zinc finger CCCH-type, antiviral 1-like 2 2
MIRT596829 Ttll1 tubulin tyrosine ligase-like 1 2 2
MIRT596860 Ttc26 tetratricopeptide repeat domain 26 2 2
MIRT596941 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 2 2
MIRT596960 Tmem88b transmembrane protein 88B 2 2
MIRT597020 Thap2 THAP domain containing, apoptosis associated protein 2 2 2
MIRT597136 Sumf2 sulfatase modifying factor 2 2 2
MIRT597317 Sgol2 shugoshin 2A 2 2
MIRT597336 Sema4b sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B 2 2
MIRT597342 Sec23ip Sec23 interacting protein 2 2
MIRT597418 Rpl7l1 ribosomal protein L7-like 1 2 2
MIRT597468 Trmt10a tRNA methyltransferase 10A 1 1
MIRT597714 Pphln1 periphilin 1 2 2
MIRT597803 Pla2r1 phospholipase A2 receptor 1 2 2
MIRT597858 Pfkl phosphofructokinase, liver, B-type 2 2
MIRT597896 Paxip1 PAX interacting (with transcription-activation domain) protein 1 2 2
MIRT598034 Noc3l NOC3 like DNA replication regulator 2 2
MIRT598039 Nkiras1 NFKB inhibitor interacting Ras-like protein 1 2 2
MIRT598078 Neu3 neuraminidase 3 2 2
MIRT598116 Ncan neurocan 2 2
MIRT598283 Mdc1 mediator of DNA damage checkpoint 1 2 2
MIRT598324 Mbd4 methyl-CpG binding domain protein 4 2 2
MIRT598408 Ly6g6d lymphocyte antigen 6 complex, locus G6D 2 2
MIRT598460 Krt222 keratin 222 2 2
MIRT598470 Klhdc9 kelch domain containing 9 2 2
MIRT598474 Kif15 kinesin family member 15 2 2
MIRT598527 Itsn1 intersectin 1 (SH3 domain protein 1A) 2 2
MIRT598712 H2afv H2A histone family, member V 2 2
MIRT598805 Gm5113 predicted gene 5113 2 2
MIRT598950 Ggps1 geranylgeranyl diphosphate synthase 1 2 2
MIRT599059 Epb4.2 erythrocyte membrane protein band 4.2 2 2
MIRT599132 Dqx1 DEAQ RNA-dependent ATPase 2 2
MIRT599204 Ddhd2 DDHD domain containing 2 2 2
MIRT599269 D14Abb1e family with sequence similarity 208, member A 2 2
MIRT599281 Cyld CYLD lysine 63 deubiquitinase 2 2
MIRT599345 Commd7 COMM domain containing 7 2 2
MIRT599454 Cdnf cerebral dopamine neurotrophic factor 2 2
MIRT599599 Bloc1s3 biogenesis of lysosomal organelles complex-1, subunit 3 2 2
MIRT599612 Birc5 baculoviral IAP repeat-containing 5 2 2
MIRT599652 B4galnt2 beta-1,4-N-acetyl-galactosaminyl transferase 2 2 2
MIRT599710 Apod apolipoprotein D 2 2
MIRT599856 Actr10 ARP10 actin-related protein 10 2 2
MIRT599933 Rmi2 RecQ mediated genome instability 2 1 1
MIRT600084 2010315B03Rik RIKEN cDNA 2010315B03 gene 2 2
MIRT600161 Zbtb44 zinc finger and BTB domain containing 44 2 2
MIRT600240 Trim36 tripartite motif-containing 36 2 2
MIRT600284 Tmem69 transmembrane protein 69 2 2
MIRT600548 Padi2 peptidyl arginine deiminase, type II 2 2
MIRT600665 March5 membrane-associated ring finger (C3HC4) 5 2 2
MIRT600678 Mapre1 microtubule-associated protein, RP/EB family, member 1 2 2
MIRT600855 Gas2l3 growth arrest-specific 2 like 3 2 2
MIRT600920 Exoc8 exocyst complex component 8 2 2
MIRT600932 Elovl7 ELOVL family member 7, elongation of long chain fatty acids (yeast) 2 2
MIRT601045 Cnih4 cornichon family AMPA receptor auxiliary protein 4 2 2
MIRT601079 Ccdc85b coiled-coil domain containing 85B 2 2
MIRT601085 Cbln3 cerebellin 3 precursor protein 2 2
MIRT601269 Soga1 suppressor of glucose, autophagy associated 1 1 1
MIRT601283 Saysd1 SAYSVFN motif domain containing 1 1 1
MIRT601312 Zfp830 zinc finger protein 830 2 2
MIRT601419 Tyr tyrosinase 2 2
MIRT601456 Tnfsf10 tumor necrosis factor (ligand) superfamily, member 10 2 2
MIRT601640 Slc12a8 solute carrier family 12 (potassium/chloride transporters), member 8 2 2
MIRT601654 Sfxn2 sideroflexin 2 2 2
MIRT601763 Ranbp3l RAN binding protein 3-like 2 2
MIRT601846 Polr1b polymerase (RNA) I polypeptide B 2 2
MIRT601982 Nanog Nanog homeobox 2 2
MIRT602082 Lrp4 low density lipoprotein receptor-related protein 4 2 2
MIRT602092 Ldlrad2 low density lipoprotein receptor A domain containing 2 2 2
MIRT602145 Ajuba ajuba LIM protein 1 1
MIRT602297 Gla galactosidase, alpha 2 2
MIRT602341 Fundc2 FUN14 domain containing 2 2 2
MIRT602343 Fnip2 folliculin interacting protein 2 2 2
MIRT602500 Dffb DNA fragmentation factor, beta subunit 2 2
MIRT602600 Chrna1 cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) 2 2
MIRT602625 Cenpl centromere protein L 2 2
MIRT602643 Cd93 CD93 antigen 2 2
MIRT602957 Xpo7 exportin 7 2 2
MIRT603093 Zfp287 zinc finger protein 287 2 2
MIRT603325 Slc35d2 solute carrier family 35, member D2 2 2
MIRT603487 Rbm11 RNA binding motif protein 11 2 2
MIRT603511 Rab11b RAB11B, member RAS oncogene family 2 2
MIRT603603 Pigv phosphatidylinositol glycan anchor biosynthesis, class V 2 2
MIRT603985 Gm7616 predicted gene 7616 2 2
MIRT604003 Gje1 gap junction protein, epsilon 1 2 2
MIRT604009 Ggcx gamma-glutamyl carboxylase 2 2
MIRT604106 Dis3l DIS3 like exosome 3'-5' exoribonuclease 2 2
MIRT604126 Ddx58 DEAD (Asp-Glu-Ala-Asp) box polypeptide 58 2 2
MIRT604162 Cyb5d2 cytochrome b5 domain containing 2 2 2
MIRT604521 1200011I18Rik GPALPP motifs containing 1 2 2
MIRT604574 Ttyh1 tweety family member 1 2 2
MIRT604611 Tbl1xr1 transducin (beta)-like 1X-linked receptor 1 2 2
MIRT604687 Sgk3 serum/glucocorticoid regulated kinase 3 2 2
MIRT604843 Mrpl35 mitochondrial ribosomal protein L35 2 2
MIRT604895 Kdelc2 KDEL (Lys-Asp-Glu-Leu) containing 2 2 2
MIRT605026 Eif4g2 eukaryotic translation initiation factor 4, gamma 2 2 2
MIRT605125 Cnnm3 cyclin M3 2 2
MIRT605148 Ccdc55 nuclear speckle regulatory protein 1 2 2
MIRT605382 Ube2v2 ubiquitin-conjugating enzyme E2 variant 2 2 2
MIRT605728 Gm5531 transmembrane epididymal protein 1B 2 2
MIRT605749 Fam161b family with sequence similarity 161, member B 2 2
MIRT605782 Depdc5 DEP domain containing 5 2 2
MIRT605908 Zmat3 zinc finger matrin type 3 2 2
MIRT605997 Homez homeodomain leucine zipper-encoding gene 2 2
MIRT606072 Zfp282 zinc finger protein 282 2 2
MIRT606110 Ubxn8 UBX domain protein 8 2 2
MIRT606199 Sfxn4 sideroflexin 4 2 2
MIRT606222 Rhoh ras homolog family member H 2 2
MIRT606267 Pfas phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) 2 2
MIRT606284 Nufip1 nuclear fragile X mental retardation protein interacting protein 1 2 2
MIRT606325 Mrps24 mitochondrial ribosomal protein S24 2 2
MIRT606341 Lrrc39 leucine rich repeat containing 39 2 2
MIRT606443 Fam118a family with sequence similarity 118, member A 2 2
MIRT606461 Ecm2 extracellular matrix protein 2, female organ and adipocyte specific 2 2
MIRT606481 Ctsa cathepsin A 2 2
MIRT606485 Ctcfl CCCTC-binding factor (zinc finger protein)-like 2 2
MIRT606512 Bpnt1 bisphosphate 3'-nucleotidase 1 2 2
MIRT606599 Tmem206 transmembrane protein 206 2 2

Error report submission